feat: Merqury (#540)

<!-- Ensure that the PR title follows conventional commit style (<type>:
<description>)-->
<!-- Possible types are here:
https://github.com/commitizen/conventional-commit-types/blob/master/index.json
-->

### Description

<!-- Add a description of your PR here-->

### QC
<!-- Make sure that you can tick the boxes below. -->

* [x] I confirm that:

For all wrappers added by this PR, 

* there is a test case which covers any introduced changes,
* `input:` and `output:` file paths in the resulting rule can be changed
arbitrarily,
* either the wrapper can only use a single core, or the example rule
contains a `threads: x` statement with `x` being a reasonable default,
* rule names in the test case are in
[snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell
what the rule is about or match the tools purpose or name (e.g.,
`map_reads` for a step that maps reads),
* all `environment.yaml` specifications follow [the respective best
practices](https://stackoverflow.com/a/64594513/2352071),
* wherever possible, command line arguments are inferred and set
automatically (e.g. based on file extensions in `input:` or `output:`),
* all fields of the example rules in the `Snakefile`s and their entries
are explained via comments (`input:`/`output:`/`params:` etc.),
* `stderr` and/or `stdout` are logged correctly (`log:`), depending on
the wrapped tool,
* temporary files are either written to a unique hidden folder in the
working directory, or (better) stored where the Python function
`tempfile.gettempdir()` points to (see
[here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir);
this also means that using any Python `tempfile` default behavior
works),
* the `meta.yaml` contains a link to the documentation of the respective
tool or command,
* `Snakefile`s pass the linting (`snakemake --lint`),
* `Snakefile`s are formatted with
[snakefmt](https://github.com/snakemake/snakefmt),
* Python wrapper scripts are formatted with
[black](https://black.readthedocs.io).
* Conda environments use a minimal amount of channels, in recommended
ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as
conda-forge should have highest priority and defaults channels are
usually not needed because most packages are in conda-forge nowadays).

bio/merqury/environment.yaml

@@ -0,0 +1,6 @@
+channels:
+  - conda-forge
+  - bioconda
+  - nodefaults
+dependencies:
+  - merqury =1.3

bio/merqury/meta.yaml

@@ -0,0 +1,14 @@
+name: Merqury
+description: |
+ Evaluate genome assemblies with k-mers and more.
+url: https://github.com/marbl/merqury
+authors:
+  - Filipe G. Vieira
+input:
+  - one on two assembly fasta file(s)
+  - meryl database
+output:
+  - annotation quality files
+notes: |
+  * `Merqury` does not return non-zero exit code when it fails, so always include (at least) one PNG file in your rule's output.
+  * `Merqury` does not allow for extra params.

bio/merqury/test/Snakefile

@@ -0,0 +1,67 @@
+rule run_merqury_haploid:
+    input:
+        fasta="hap1.fasta",
+        meryldb="meryldb",
+    output:
+        # meryldb output
+        filt="results/haploid/meryldb.filt",
+        hist="results/haploid/meryldb.hist",
+        hist_ploidy="results/haploid/meryldb.hist.ploidy",
+        # general output
+        completeness_stats="results/haploid/out.completeness.stats",
+        dist_only_hist="results/haploid/out.dist.only.hist",
+        qv="results/haploid/out.qv",
+        spectra_asm_hist="results/haploid/out.spectra_asm.hist",
+        spectra_asm_ln_png="results/haploid/out.spectra_asm.png",
+        # haplotype-specific output
+        fas1_only_bed="results/haploid/hap1.bed",
+        fas1_only_wig="results/haploid/hap1.wig",
+        fas1_only_hist="results/haploid/hap1.hist",
+        fas1_qv="results/haploid/hap1.qv",
+        fas1_spectra_cn_hist="results/haploid/hap1.spectra.hist",
+        fas1_spectra_cn_ln_png="results/haploid/hap1.spectra.png",
+    log:
+        std="logs/haploid.log",
+        spectra_cn="logs/haploid.spectra-cn.log",
+    threads: 1
+    wrapper:
+        "master/bio/merqury"
+
+
+rule run_merqury_diploid:
+    input:
+        fasta=["hap1.fasta", "hap2.fasta"],
+        meryldb="meryldb",
+    output:
+        # meryldb output
+        filt="results/diploid/meryldb.filt",
+        hist="results/diploid/meryldb.hist",
+        hist_ploidy="results/diploid/meryldb.hist.ploidy",
+        # general output
+        completeness_stats="results/diploid/out.completeness.stats",
+        dist_only_hist="results/diploid/out.dist.only.hist",
+        only_hist="results/diploid/out.only.hist",
+        qv="results/diploid/out.qv",
+        spectra_asm_hist="results/diploid/out.spectra_asm.hist",
+        spectra_asm_ln_png="results/diploid/out.spectra_asm.png",
+        spectra_cn_hist="results/diploid/out.spectra_cn.hist",
+        spectra_cn_ln_png="results/diploid/out.spectra_cn.png",
+        # haplotype-specific output
+        fas1_only_bed="results/diploid/hap1.bed",
+        fas1_only_wig="results/diploid/hap1.wig",
+        fas1_only_hist="results/diploid/hap1.hist",
+        fas1_qv="results/diploid/hap1.qv",
+        fas1_spectra_cn_hist="results/diploid/hap1.spectra.hist",
+        fas1_spectra_cn_ln_png="results/diploid/hap1.spectra.png",
+        fas2_only_bed="results/diploid/hap2.bed",
+        fas2_only_wig="results/diploid/hap2.wig",
+        fas2_only_hist="results/diploid/hap2.hist",
+        fas2_qv="results/diploid/hap2.qv",
+        fas2_spectra_cn_hist="results/diploid/hap2.spectra.hist",
+        fas2_spectra_cn_ln_png="results/diploid/hap2.spectra.png",
+    log:
+        std="logs/diploid.log",
+        spectra_cn="logs/diploid.spectra-cn.log",
+    threads: 1
+    wrapper:
+        "master/bio/merqury"

bio/merqury/test/hap1.fasta

@@ -0,0 +1,2 @@
+>Sheila
+GCTAGCTCAGAAAAAAAAAAGATGCGAGGCGTAGGCGATGCGATCGATCGATCTATAGGCTCGAGGCTAGGGCTAGCTGA

bio/merqury/test/hap2.fasta

@@ -0,0 +1,2 @@
+>Sheila
+GCTAGCTCAGAAAAAAAAAAGATGCGAGGCGTAGGCGATGCGATCGATCGATCTATAGGCTCGAGGCTAGGGCTAGCTGA

bio/merqury/wrapper.py

@@ -0,0 +1,132 @@
+__author__ = "Filipe G. Vieira"
+__copyright__ = "Copyright 2022, Filipe G. Vieira"
+__license__ = "MIT"
+
+
+import os
+import tempfile
+from pathlib import Path
+from snakemake.shell import shell
+
+meryldb_parents = snakemake.input.get("meryldb_parents", "")
+out_prefix = "out"
+log_tmp = "__LOG__.tmp"
+
+
+def save_output(out_prefix, ext, cwd, file):
+    if file is None:
+        return 0
+    src = f"{out_prefix}{ext}"
+    dest = cwd / file
+    shell("cat {src} > {dest}")
+
+
+with tempfile.TemporaryDirectory() as tmpdir:
+    cwd = Path.cwd()
+    # Create symlinks for input files
+    for input in snakemake.input:
+        src = Path(input)
+        dst = Path(tmpdir) / input
+        src = Path(os.path.relpath(src.resolve(), dst.resolve().parent))
+        dst.symlink_to(src)
+    os.chdir(tmpdir)
+
+    shell(
+        "merqury.sh"
+        " {snakemake.input.meryldb}"
+        " {meryldb_parents}"
+        " {snakemake.input.fasta}"
+        " {out_prefix}"
+        " > {log_tmp} 2>&1"
+    )
+
+    ### Saving LOG files
+    save_output(log_tmp, "", cwd, snakemake.log.get("std"))
+    for type in ["spectra_cn"]:
+        save_output(
+            f"logs/{out_prefix}",
+            "." + type.replace("_", "-") + ".log",
+            cwd,
+            snakemake.log.get(type),
+        )
+
+    ### Saving OUTPUT files
+    # EXT: replace all "_" with "."
+    meryldb = Path(snakemake.input.meryldb.rstrip("/")).stem
+    for type in ["filt", "hist", "hist_ploidy"]:
+        save_output(
+            meryldb, "." + type.replace("_", "."), cwd, snakemake.output.get(type)
+        )
+
+    # EXT: replace last "_" with "."
+    for type in [
+        "completeness_stats",
+        "dist_only_hist",
+        "only_hist",
+        "qv",
+        "hapmers_count",
+        "hapmers_blob_png",
+    ]:
+        save_output(
+            out_prefix,
+            "." + type[::-1].replace("_", ".", 1)[::-1],
+            cwd,
+            snakemake.output.get(type),
+        )
+
+    # EXT: replace first "_" with "-", and remaining with "."
+    for type in [
+        "spectra_asm_hist",
+        "spectra_asm_ln_png",
+        "spectra_asm_fl_png",
+        "spectra_asm_st_png",
+        "spectra_cn_hist",
+        "spectra_cn_ln_png",
+        "spectra_cn_fl_png",
+        "spectra_cn_st_png",
+    ]:
+        save_output(
+            out_prefix,
+            "." + type.replace("_", ".").replace(".", "-", 1),
+            cwd,
+            snakemake.output.get(type),
+        )
+
+    input_fas = snakemake.input.fasta
+    if isinstance(input_fas, str):
+        input_fas = [input_fas]
+
+    for fas in range(1, len(input_fas) + 1):
+        prefix = Path(input_fas[fas - 1]).name.removesuffix(".fasta")
+
+        # EXT: remove everything until first "_" and replace last "_" with "."
+        for type in [f"fas{fas}_only_bed", f"fas{fas}_only_wig"]:
+            save_output(
+                prefix,
+                type[type.find("_") :][::-1].replace("_", ".", 1)[::-1],
+                cwd,
+                snakemake.output.get(type),
+            )
+
+        # EXT: remove everything until first "_" and replace all "_" with "."
+        for type in [f"fas{fas}_only_hist", f"fas{fas}_qv"]:
+            save_output(
+                f"{out_prefix}.{prefix}",
+                type[type.find("_") :].replace("_", "."),
+                cwd,
+                snakemake.output.get(type),
+            )
+
+        # EXT: remove everything until first "_", replace first "_" with "-", and remaining with "."
+        for type in [
+            f"fas{fas}_spectra_cn_hist",
+            f"fas{fas}_spectra_cn_ln_png",
+            f"fas{fas}_spectra_cn_fl_png",
+            f"fas{fas}_spectra_cn_st_png",
+        ]:
+            save_output(
+                f"{out_prefix}.{prefix}",
+                "." + type[type.find("_") + 1 :].replace("_", ".").replace(".", "-", 1),
+                cwd,
+                snakemake.output.get(type),
+            )

test.py

@@ -495,6 +495,21 @@ def test_salsa2():
     )
 
 
+@skip_if_not_modified
+def test_merqury_haploid():
+    run(
+        "bio/merqury",
+        ["snakemake", "--cores", "1", "results/haploid/out.qv", "--use-conda", "-F"],
+    )
+
+@skip_if_not_modified
+def test_merqury_diploid():
+    run(
+        "bio/merqury",
+        ["snakemake", "--cores", "1", "results/diploid/out.qv", "--use-conda", "-F"],
+    )
+
+
 @skip_if_not_modified
 def test_mashmap():
     run(