feat: Bowtie2 meta (#1586)

<!-- Ensure that the PR title follows conventional commit style (<type>:
<description>)-->
<!-- Possible types are here:
https://github.com/commitizen/conventional-commit-types/blob/master/index.json
-->

### Description

This meta-wrapper simply aligns, filters and deduplicates reads. I've
been helping co-workers with Snakemake basics and snakemake-wrappers,
and I used this very short pipeline.

### QC
<!-- Make sure that you can tick the boxes below. -->

* [X] I confirm that:

For all wrappers added by this PR, 

* there is a test case which covers any introduced changes,
* `input:` and `output:` file paths in the resulting rule can be changed
arbitrarily,
* either the wrapper can only use a single core, or the example rule
contains a `threads: x` statement with `x` being a reasonable default,
* rule names in the test case are in
[snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell
what the rule is about or match the tools purpose or name (e.g.,
`map_reads` for a step that maps reads),
* all `environment.yaml` specifications follow [the respective best
practices](https://stackoverflow.com/a/64594513/2352071),
* wherever possible, command line arguments are inferred and set
automatically (e.g. based on file extensions in `input:` or `output:`),
* all fields of the example rules in the `Snakefile`s and their entries
are explained via comments (`input:`/`output:`/`params:` etc.),
* `stderr` and/or `stdout` are logged correctly (`log:`), depending on
the wrapped tool,
* temporary files are either written to a unique hidden folder in the
working directory, or (better) stored where the Python function
`tempfile.gettempdir()` points to (see
[here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir);
this also means that using any Python `tempfile` default behavior
works),
* the `meta.yaml` contains a link to the documentation of the respective
tool or command,
* `Snakefile`s pass the linting (`snakemake --lint`),
* `Snakefile`s are formatted with
[snakefmt](https://github.com/snakemake/snakefmt),
* Python wrapper scripts are formatted with
[black](https://black.readthedocs.io).
* Conda environments use a minimal amount of channels, in recommended
ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as
conda-forge should have highest priority and defaults channels are
usually not needed because most packages are in conda-forge nowadays).

---------

Co-authored-by: tdayris <tdayris@gustaveroussy.fr>
Co-authored-by: tdayris <thibault.dayris@gustaveroussy.fr>
Co-authored-by: Johannes Köster <johannes.koester@uni-due.de>
Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com>
Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Co-authored-by: Felix Mölder <felix.moelder@uni-due.de>
Co-authored-by: Christopher Schröder <christopher.schroeder@tu-dortmund.de>

meta/bio/bowtie2_sambamba/meta.yaml

@@ -0,0 +1,22 @@
+name: Bowtie2 Sambamba
+url: http://lomereiter.github.io/sambamba/
+description: >
+  Map reads with Bowtie 2, and post-process alignments with Sambamba.
+
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Step           | Tool     | Reason                                                                                       |
+  +================+==========+==============================================================================================+
+  | Indexation     | Bowtie 2 | Create genome sequence index                                                                 |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Mapping        | Bowtie 2 | Perform read mapping                                                                         |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Sort           | Sambamba | Perform sort based on mapping position                                                       |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Quality filter | Sambamba | Perform mapping quality filter                                                               |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Deduplication  | Sambamba | Identify possible sequencing duplicates                                                      |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Indexation     | Sambamba | Index deduplicated reads                                                                     |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+authors:
+  - Thibault Dayris

meta/bio/bowtie2_sambamba/test/Sample1.R1.fastq

@@ -0,0 +1,32 @@
+@1
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@2
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@3
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@4
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@5
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@6
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@7
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@8
+GTATCGATCCGATTA
++
+IIIIIIIIIIIIIII

meta/bio/bowtie2_sambamba/test/Sample1.R2.fastq

@@ -0,0 +1,32 @@
+@1
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@2
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@3
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@4
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@5
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@6
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@7
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@8
+ATATCGATCGACGAT
++
+IIIIIIIIIIIIIII

meta/bio/bowtie2_sambamba/test/Snakefile

@@ -0,0 +1,105 @@
+rule bowtie2_build:
+    input:
+        ref="genome.fasta",
+    output:
+        multiext(
+            "genome",
+            ".1.bt2",
+            ".2.bt2",
+            ".3.bt2",
+            ".4.bt2",
+            ".rev.1.bt2",
+            ".rev.2.bt2",
+        ),
+    log:
+        "logs/bowtie2_build/build.log",
+    params:
+        extra="",
+    threads: 8
+    wrapper:
+        "master/bio/bowtie2/build"
+
+
+rule bowtie2_alignment:
+    input:
+        sample=["{sample}.R1.fastq", "{sample}.R2.fastq"],
+        idx=multiext(
+            "genome",
+            ".1.bt2",
+            ".2.bt2",
+            ".3.bt2",
+            ".4.bt2",
+            ".rev.1.bt2",
+            ".rev.2.bt2",
+        ),
+    output:
+        temp("mapped/{sample}.bam"),
+    log:
+        "logs/bowtie2/{sample}.log",
+    params:
+        extra=(
+            " --rg-id {sample} "
+            "--rg 'SM:{sample} LB:FakeLib PU:FakePU.1.{sample} PL:ILLUMINA' "
+        ),
+    threads: 8
+    wrapper:
+        "master/bio/bowtie2/align"
+
+
+rule sambamba_sort:
+    input:
+        "mapped/{sample}.bam",
+    output:
+        temp("mapped/{sample}.sorted.bam"),
+    params:
+        "",
+    log:
+        "logs/sambamba-sort/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/sort"
+
+
+rule sambamba_view:
+    input:
+        "mapped/{sample}.sorted.bam",
+    output:
+        temp("mapped/{sample}.filtered.bam"),
+    params:
+        extra=(
+            " --format 'bam' "
+            "--filter 'mapping_quality >= 30 and not (unmapped or mate_is_unmapped)' "
+        ),
+    log:
+        "logs/sambamba-view/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/view"
+
+
+rule sambamba_markdup:
+    input:
+        "mapped/{sample}.filtered.bam",
+    output:
+        "mapped/{sample}.rmdup.bam",
+    params:
+        extra=" --remove-duplicates ",  # optional parameters
+    log:
+        "logs/sambamba-markdup/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/markdup"
+
+
+rule sambamba_index:
+    input:
+        "mapped/{sample}.rmdup.bam",
+    output:
+        "mapped/{sample}.rmdup.bam.bai",
+    params:
+        extra="",
+    log:
+        "logs/sambamba-index/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/index"

meta/bio/bowtie2_sambamba/test/genome.fasta

@@ -0,0 +1,3 @@
+>FakeChrom
+ATCGATGCTGCTATAGCTATAGCTCTAGATCTGATCTGCTAGTATCGATCCGATTATTAGCGCGATTATAGCGTAGTCA
+ATCGATCTCGATATCGCGCTACGATCCGCGCGCGCGCGCGCATTATATCGATCGACGATGCTGCTAGCTAGCTGCTAGC

meta/bio/bowtie2_sambamba/used_wrappers.yaml

@@ -0,0 +1,7 @@
+wrappers:
+  - bio/bowtie2/build
+  - bio/bowtie2/align
+  - bio/sambamba/sort
+  - bio/sambamba/view
+  - bio/sambamba/markdup
+  - bio/sambamba/index

test.py

@@ -5688,6 +5688,22 @@ def test_calc_consensus_reads():
     )
 
 
+
+@skip_if_not_modified
+def test_bowtie2_sambamba_meta():
+    run(
+        "meta/bio/bowtie2_sambamba",
+        [
+            "snakemake",
+            "--cores",
+            "2",
+            "--use-conda",
+            "-F",
+            "mapped/Sample1.rmdup.bam.bai"
+        ]
+    )
+
+
 @skip_if_not_modified
 def test_bazam_interleaved():
     run(