perf: autobump bio/kallisto/index (#1708)

Automatic update of bio/kallisto/index. --------- Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Co-authored-by: Filipe G. Vieira <1151762+fgvieira@users.noreply.github.com>
snakemake · Aug 1, 2023 · a84c0ab · a84c0ab
1 parent 6d95e56
commit a84c0ab
Show file tree

Hide file tree

Showing 4 changed files with 15 additions and 7 deletions.
diff --git a/bio/kallisto/index/environment.yaml b/bio/kallisto/index/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - kallisto =0.48.0
+  - kallisto =0.50.0
diff --git a/bio/kallisto/index/meta.yaml b/bio/kallisto/index/meta.yaml
@@ -1,4 +1,11 @@
 name: "kallisto index"
 description: Index a transcriptome using kallisto.
+url: https://github.com/pachterlab/kallisto
 authors:
   - Joël Simoneau
+input:
+  - fasta: FASTA file to index
+output:
+  - index: indexed file
+params:
+  - extra: Additional parameters
diff --git a/bio/kallisto/index/test/transcriptome.fasta b/bio/kallisto/index/test/transcriptome.fasta
@@ -1,2 +1,2 @@
 >Sheila
-GCTAGCTCAGAAAAAAAAAA
+GCTAGCTCAGAAAAAAAAAATCGTCGCGTGCGCGT
diff --git a/bio/kallisto/index/wrapper.py b/bio/kallisto/index/wrapper.py
@@ -19,9 +19,10 @@
 fasta = " ".join(fasta) if isinstance(fasta, list) else fasta
 
 shell(
-    "kallisto index "  # Tool
-    "{extra} "  # Optional parameters
-    "--index={snakemake.output.index} "  # Output file
-    "{fasta} "  # Input FASTA files
-    "{log}"  # Logging
+    "kallisto index"  # Tool
+    " --threads {snakemake.threads}"
+    " {extra}"  # Optional parameters
+    " --index {snakemake.output.index}"  # Output file
+    " {fasta}"  # Input FASTA files
+    " {log}"  # Logging
 )