Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
perf: autobump bio/kallisto/index (#1708)
Automatic update of bio/kallisto/index. --------- Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Co-authored-by: Filipe G. Vieira <1151762+fgvieira@users.noreply.github.com>
- Loading branch information
1 parent
6d95e56
commit a84c0ab
Showing
4 changed files
with
15 additions
and
7 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
|
@@ -3,4 +3,4 @@ channels: | |
- bioconda | ||
- nodefaults | ||
dependencies: | ||
- kallisto =0.48.0 | ||
- kallisto =0.50.0 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,4 +1,11 @@ | ||
name: "kallisto index" | ||
description: Index a transcriptome using kallisto. | ||
url: https://github.com/pachterlab/kallisto | ||
authors: | ||
- Joël Simoneau | ||
input: | ||
- fasta: FASTA file to index | ||
output: | ||
- index: indexed file | ||
params: | ||
- extra: Additional parameters |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,2 @@ | ||
>Sheila | ||
GCTAGCTCAGAAAAAAAAAA | ||
GCTAGCTCAGAAAAAAAAAATCGTCGCGTGCGCGT |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters