feat: genefuse wrapper (#493)

* feat: genefuse wrapper

* fix: set strict mode for conda channels

* feat: write output files to a temp folder

* docs: update meta data

* Removed format

* Added URL

* Changed extra

* Removed format

* Removed format

* Removed format

* Removed format

* Removed patch version

Co-authored-by: Filipe G. Vieira <fgarrettvieira@gmail.com>

.github/workflows/main.yml

@@ -19,7 +19,7 @@ jobs:
         run: |
           export PATH="/usr/share/miniconda/bin:$PATH"
           pip install -r docs/requirements.txt
-      
+
       - name: Test doc generation
         run: |
           export PATH="/usr/share/miniconda/bin:$PATH"
@@ -57,6 +57,6 @@ jobs:
           # activate conda env
           export PATH="/usr/share/miniconda/bin:$PATH"
           source activate snakemake
-          
+
           # run tests
           pytest test.py -v

bio/genefuse/environment.yaml

@@ -0,0 +1,6 @@
+channels:
+  - bioconda
+  - conda-forge
+  - defaults
+dependencies:
+  - genefuse=0.6

bio/genefuse/meta.yaml

@@ -0,0 +1,15 @@
+name: GeneFuse
+description: A tool to detect and visualize target gene fusions by scanning FASTQ files directly.
+url: https://github.com/OpenGene/GeneFuse
+authors:
+  - Patrik Smeds
+input:
+  - fastq files
+  - gene fuse settings files
+  - refeference genome
+output:
+  - txt file with fusions
+  - html report
+  - json report
+notes: |
+  * The `extra` param allows for additional program arguments.

bio/genefuse/test/Snakefile

@@ -0,0 +1,18 @@
+rule genefuse:
+    input:
+        fastq1="reads/{sample}_R1.fastq",
+        fastq2="reads/{sample}_R2.fastq",
+        config="genes.csv",
+        reference="genome.fasta",
+    output:
+        html="{sample}_genefuse_report.html",
+        json="{sample}_genefuse_report.json",
+        fusions="{sample}_fusions.txt",
+    log:
+        "logs/{sample}_genefuse.log",
+    params:
+        # optional parameters
+        extra="",
+    threads:1
+    wrapper:
+        "master/bio/genefuse"

bio/genefuse/test/genes.csv

@@ -0,0 +1,7 @@
+>GENE,chr1:10-70
+1,15,20
+2,25,30
+3,35,40
+4,45,50
+5,55,60
+6,65,70

bio/genefuse/test/genome.fasta

@@ -0,0 +1,2 @@
+>chr1
+GCTAGCTCAGAAAAAAAAAAGATGCGAGGCGTAGGCGATGCGATCGATCGATCTATAGGCTCGAGGCTAGGGCTAGCTGA

bio/genefuse/test/reads/a_R1.fastq

@@ -0,0 +1,4 @@
+@1
+CTCAGGAGGC
++
+!!!!!!!!!!

bio/genefuse/test/reads/a_R2.fastq

@@ -0,0 +1,4 @@
+@1
+CTCAGGAGGC
++
+!!!!!!!!!!

bio/genefuse/wrapper.py

@@ -0,0 +1,41 @@
+__author__ = "Patrik Smeds"
+__copyright__ = "Copyright 2022, Patrik Smeds"
+__email__ = "patrik.smeds@scilifelab.uu.se"
+__license__ = "MIT"
+
+
+from snakemake.shell import shell
+from tempfile import TemporaryDirectory
+
+# Formats the log redrection string
+log = snakemake.log_fmt_shell(stdout=False, stderr=True)
+
+extra = snakemake.params.get("extra", "")
+
+with TemporaryDirectory() as tempdir:
+    # Executed shell command
+    html_path = f"{tempdir}/genefuse.html"
+    json_path = f"{tempdir}/genefuse.json"
+    txt_path = f"{tempdir}/gene_fuse_fusions.txt"
+    shell(
+        "(genefuse "
+        "-r {snakemake.input.reference} "
+        "-t {snakemake.threads} "
+        "-f {snakemake.input.config} "
+        "-1 {snakemake.input.fastq1} "
+        "-2 {snakemake.input.fastq2} "
+        "-h {html_path} "
+        "-j {json_path} "
+        "{extra} > "
+        "{txt_path}) "
+        "{log}"
+    )
+
+    if snakemake.output.get("html", None):
+        shell("mv {html_path} {snakemake.output.html}")
+
+    if snakemake.output.get("json", None):
+        shell("mv {json_path} {snakemake.output.json}")
+
+    if snakemake.output.get("fusions", None):
+        shell("mv {txt_path} {snakemake.output.fusions}")

test.py

@@ -4510,6 +4510,14 @@ def test_vep_annotate():
     )
 
 
+@skip_if_not_modified
+def test_genefuse():
+    run(
+        "bio/genefuse",
+        ["snakemake", "--cores", "1", "--use-conda", "-F", "a_fusions.txt", "a_genefuse_report.html"],
+    )
+
+
 @skip_if_not_modified
 def test_genomepy():
     # download dm3 genome (relatively small, +/- 250 mb)