feat: GATK SplitIntervals wrapper (#836)

<!-- Ensure that the PR title follows conventional commit style (<type>:
<description>)-->
<!-- Possible types are here:
https://github.com/commitizen/conventional-commit-types/blob/master/index.json
-->

### Description

<!-- Add a description of your PR here-->

### QC
<!-- Make sure that you can tick the boxes below. -->

* [x] I confirm that:

For all wrappers added by this PR, 

* there is a test case which covers any introduced changes,
* `input:` and `output:` file paths in the resulting rule can be changed
arbitrarily,
* either the wrapper can only use a single core, or the example rule
contains a `threads: x` statement with `x` being a reasonable default,
* rule names in the test case are in
[snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell
what the rule is about or match the tools purpose or name (e.g.,
`map_reads` for a step that maps reads),
* all `environment.yaml` specifications follow [the respective best
practices](https://stackoverflow.com/a/64594513/2352071),
* wherever possible, command line arguments are inferred and set
automatically (e.g. based on file extensions in `input:` or `output:`),
* all fields of the example rules in the `Snakefile`s and their entries
are explained via comments (`input:`/`output:`/`params:` etc.),
* `stderr` and/or `stdout` are logged correctly (`log:`), depending on
the wrapped tool,
* temporary files are either written to a unique hidden folder in the
working directory, or (better) stored where the Python function
`tempfile.gettempdir()` points to (see
[here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir);
this also means that using any Python `tempfile` default behavior
works),
* the `meta.yaml` contains a link to the documentation of the respective
tool or command,
* `Snakefile`s pass the linting (`snakemake --lint`),
* `Snakefile`s are formatted with
[snakefmt](https://github.com/snakemake/snakefmt),
* Python wrapper scripts are formatted with
[black](https://black.readthedocs.io).
* Conda environments use a minimal amount of channels, in recommended
ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as
conda-forge should have highest priority and defaults channels are
usually not needed because most packages are in conda-forge nowadays).

bio/gatk/applybqsr/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk ApplyBQSR
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570337264923-ApplyBQSR
 description: |
   Run gatk ApplyBQSR.
 authors:
@@ -15,4 +16,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360037055712-ApplyBQSR

bio/gatk/applybqsrspark/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk ApplyBQSRSpark
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570424849051-ApplyBQSRSpark-BETA-
 description: |
   ApplyBQSRSpark: Apply base quality score recalibration on Spark; uses output of the BaseRecalibrator tool.
 authors:
@@ -15,4 +16,3 @@ notes: |
   * The `spark_runner` param = "LOCAL"|"SPARK"|"GCS" allows to set the spark_runner. Set the parameter to "LOCAL" or don't set it at all to run on local machine.
   * The `spark_master` param allows to set the URL of the Spark Master to submit the job. Set to "local[number_of_cores]" for local execution. Don't set it at all for local execution with number of cores determined by snakemake.
   * The `spark_extra` param allows for additional spark arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360057440431-ApplyBQSRSpark-BETA-

bio/gatk/applyvqsr/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk ApplyVQSR
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570419503259-ApplyVQSR
 description: |
   Run gatk ApplyVQSR.
 authors:
@@ -13,4 +14,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information, see https://gatk.broadinstitute.org/hc/en-us/articles/360037226332-ApplyVQSR

bio/gatk/baserecalibrator/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk BaseRecalibrator
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570376886683-BaseRecalibrator
 description: |
   Run gatk BaseRecalibrator.
 authors:
@@ -15,5 +16,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://software.broadinstitute.org/gatk/documentation/article?id=11050
-

bio/gatk/baserecalibratorspark/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk BaseRecalibratorSpark
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570309302171-BaseRecalibratorSpark-BETA-
 description: |
   Run gatk BaseRecalibratorSpark.
 authors:
@@ -18,4 +19,3 @@ notes: |
   * The `spark_runner` param = "LOCAL"|"SPARK"|"GCS" allows to set the spark_runner. Set the parameter to "LOCAL" or don't set it at all to run on local machine.
   * The `spark_master` param allows to set the URL of the Spark Master to submit the job. Set to "local[number_of_cores]" for local execution. Don't set it at all for local execution with number of cores determined by snakemake.
   * The `spark_extra` param allows for additional spark arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360036897372-BaseRecalibratorSpark-BETA-

bio/gatk/cleansam/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk CleanSam
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570531983643-CleanSam-Picard-
 description: |
   Run gatk CleanSam
 authors:
@@ -10,4 +11,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360056970832-CleanSam-Picard-

bio/gatk/combinegvcfs/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk CombineGVCFs
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570423318427-CombineGVCFs
 description: |
   Run gatk CombineGVCFs.
 authors:
@@ -12,4 +13,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://software.broadinstitute.org/gatk/documentation/article?id=11050

bio/gatk/depthofcoverage/meta.yaml

@@ -1,7 +1,7 @@
 name: gatk DepthOfCoverage
 description: |
   Run gatk DepthOfCoverage (BETA).
-url: https://gatk.broadinstitute.org/hc/en-us/articles/5358877443995-DepthOfCoverage-BETA-
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570475259291-DepthOfCoverage-BETA-
 authors:
   - Lauri Mesilaakso
 input:

bio/gatk/estimatelibrarycomplexity/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk EstimateLibraryComplexity
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570264328603-EstimateLibraryComplexity-Picard-
 description: |
   Run gatk EstimateLibraryComplexity
 authors:
@@ -10,4 +11,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360057438451-EstimateLibraryComplexity-Picard-

bio/gatk/filtermutectcalls/meta.yaml

@@ -1,5 +1,5 @@
 name: gatk FilterMutectCalls
-url: https://gatk.broadinstitute.org/hc/en-us/articles/360042476952-FilterMutectCalls
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570331605531-FilterMutectCalls
 description: |
   Run gatk FilterMutectCalls to filter variants in a Mutect2 VCF callset.
 authors:

bio/gatk/genomicsdbimport/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk GenomicsDBImport
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570326648475-GenomicsDBImport
 description: |
   Run gatk GenomicsDBImport.
 authors:
@@ -12,4 +13,3 @@ notes: |
   * The `intervals` param is mandatory
   * By default, the wrapper will create a new database (output directory must be empty or non-existent). If you want to update an existing DB, set `db_action` param to `update`.
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/4405451266331-GenomicsDBImport

bio/gatk/genotypegvcfs/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk GenotypeGVCFs
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570489472411-GenotypeGVCFs
 description: |
   Run gatk GenotypeGVCFs.
 authors:
@@ -13,4 +14,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. `-XX:ParallelGCThreads=10` (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/4405451397659-GenotypeGVCFs

bio/gatk/getpileupsummaries/meta.yaml

@@ -1,5 +1,5 @@
-name: GATK Get pileup summaries
-url: https://gatk.broadinstitute.org/hc/en-us/articles/360037593451-GetPileupSummaries
+name: GATK GetPileupSummaries
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570416554907-GetPileupSummaries
 description: Summarizes counts of reads that support reference, alternate and other alleles
 author:
   - Thibault Dayris

bio/gatk/haplotypecaller/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk HaplotypeCaller
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570334998171-HaplotypeCaller
 description: |
   Run gatk HaplotypeCaller.
 authors:
@@ -12,5 +13,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. `-XX:ParallelGCThreads=10` (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/4405451272731-HaplotypeCaller
-

bio/gatk/intervallisttobed/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk IntervalListToBed
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570392740123-IntervalListToBed-Picard-
 description: |
   Run gatk IntervalListToBed.
 authors:
@@ -10,4 +11,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360050815192-IntervalListToBed-Picard-

bio/gatk/learnreadorientationmodel/meta.yaml

@@ -1,5 +1,5 @@
-name: GATK LearnOrientationModel
-url: https://gatk.broadinstitute.org/hc/en-us/articles/4405451237147-LearnReadOrientationModel
+name: GATK LearnReadOrientationModel
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570329571227-LearnReadOrientationModel
 description: Get the maximum likelihood estimates of artifact prior probabilities in the orientation bias mixture model filter
 authors:
   - Thibault Dayris

bio/gatk/markduplicatesspark/meta.yaml

@@ -1,4 +1,5 @@
 name: GATK MarkDuplicatesSpark
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570319741083-MarkDuplicatesSpark
 description: |
   Spark implementation of Picard MarkDuplicates that allows the tool to be run in parallel on multiple cores on a local machine or multiple machines on a Spark cluster while still matching the output of the non-Spark Picard version of the tool. Since the tool requires holding all of the readnames in memory while it groups read information, machine configuration and starting sort-order impact tool performance.
 authors:
@@ -14,4 +15,3 @@ notes: |
   * The `spark_runner` param = "LOCAL"|"SPARK"|"GCS" allows to set the spark_runner. Set the parameter to "LOCAL" or don't set it at all to run on local machine.
   * The `spark_master` param allows to set the URL of the Spark Master to submit the job. Set to "local[number_of_cores]" for local execution. Don't set it at all for local execution with number of cores determined by snakemake.
   * The `spark_extra` param allows for additional spark arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360050814112-MarkDuplicatesSpark

bio/gatk/mutect/meta.yaml

@@ -1,4 +1,5 @@
 name: GATK Mutect2
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570422171291-Mutect2
 description: Call somatic SNVs and indels via local assembly of haplotypes
 authors:
   - Thibault Dayris
@@ -11,4 +12,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360037593851-Mutect2

bio/gatk/printreadsspark/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk PrintReadsSpark
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570521694747-PrintReadsSpark
 description: |
   Write reads from SAM format file (SAM/BAM/CRAM) that pass specified criteria to a new file. This is the version that can be run on Spark.
 authors:
@@ -15,4 +16,3 @@ notes: |
   * The `spark_runner` param = "LOCAL"|"SPARK"|"GCS" allows to set the spark_runner. Set the parameter to "LOCAL" or don't set it at all to run on local machine.
   * The `spark_master` param allows to set the URL of the Spark Master to submit the job. Set to "local[number_of_cores]" for local execution. Don't set it at all for local execution with number of cores determined by snakemake.
   * The `spark_extra` param allows for additional spark arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360057441531-PrintReadsSpark

bio/gatk/scatterintervalsbyns/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk ScatterIntervalsByNs
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570421542811-ScatterIntervalsByNs-Picard-
 description: |
   Run gatk ScatterIntervalsByNs.
 authors:
@@ -10,4 +11,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360057440251-ScatterIntervalsByNs-Picard-

bio/gatk/selectvariants/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk SelectVariants
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570332289307-SelectVariants
 description: |
   Run gatk SelectVariants.
 authors:
@@ -13,5 +14,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://software.broadinstitute.org/gatk/documentation/article?id=11050
-

bio/gatk/splitintervals/environment.yaml

@@ -0,0 +1,7 @@
+channels:
+  - conda-forge
+  - bioconda
+  - nodefaults
+dependencies:
+  - gatk4 =4.3.0.0
+  - snakemake-wrapper-utils =0.5.0

bio/gatk/splitintervals/meta.yaml

@@ -0,0 +1,13 @@
+name: gatk SplitIntervals
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570513631387-SplitIntervals
+description: |
+  This tool takes in intervals via the standard arguments of IntervalArgumentCollection and splits them into interval files for scattering. The resulting files contain equal number of bases. Standard GATK engine arguments include -L and -XL, interval padding, and interval set rule etc. For example, for the -L argument, the tool accepts GATK-style intervals (.list or .intervals), BED files and VCF files. See --subdivision-mode parameter for more options.
+authors:
+  - Filipe G. Vieira
+input:
+  - Intervals/BED file
+output:
+  - Several Intervals/BED files
+notes: |
+  * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
+  * The `extra` param allows for additional program arguments, but not `--scatter-count`, `--output`, `--interval-file-prefix`, `--interval-file-num-digits`, or `--extension` (automatically inferred from output files).

bio/gatk/splitintervals/test/Snakefile

@@ -0,0 +1,15 @@
+rule gatk_split_interval_list:
+    input:
+        intervals="genome.interval_list",
+        ref="genome.fasta",
+    output:
+        bed=multiext("out/genome", ".00.bed", ".01.bed", ".02.bed"),
+    log:
+        "logs/genome.log",
+    params:
+        extra="--subdivision-mode BALANCING_WITHOUT_INTERVAL_SUBDIVISION_WITH_OVERFLOW",
+        java_opts="",  # optional
+    resources:
+        mem_mb=1024,
+    wrapper:
+        "master/bio/gatk/splitintervals"

bio/gatk/splitintervals/test/genome.dict

@@ -0,0 +1,3 @@
+@HD	VN:1.5
+@SQ	SN:ref	LN:45	M5:7a66cae8ab14aef8d635bc80649e730b	UR:file:/home/johannes/scms/snakemake-wrappers/bio/picard/createsequencedictionary/test/genome.fasta
+@SQ	SN:ref2	LN:40	M5:1636753510ec27476fdd109a6684680e	UR:file:/home/johannes/scms/snakemake-wrappers/bio/picard/createsequencedictionary/test/genome.fasta

bio/gatk/splitintervals/test/genome.fasta

@@ -0,0 +1,4 @@
+>ref
+AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
+>ref2
+aggttttataaaacaattaagtctacagagcaactacgcg

bio/gatk/splitintervals/test/genome.fasta.fai

@@ -0,0 +1,2 @@
+ref	45	5	45	46
+ref2	40	57	40	41

bio/gatk/splitintervals/test/genome.interval_list

@@ -0,0 +1,7 @@
+@HD	VN:1.6	SO:coordinate
+@SQ	SN:ref	LN:45	M5:7a66cae8ab14aef8d635bc80649e730b	UR:file:/home/johannes/scms/snakemake-wrappers/bio/picard/createsequencedictionary/test/genome.fasta
+@SQ	SN:ref2	LN:40	M5:1636753510ec27476fdd109a6684680e	UR:file:/home/johannes/scms/snakemake-wrappers/bio/picard/createsequencedictionary/test/genome.fasta
+ref	3	10	+	ACGTmer
+ref	13	15	+	ACGTmer
+ref2	14	16	+	ACGTmer
+ref2	20	22	+	ACGTmer

bio/gatk/splitintervals/wrapper.py

@@ -0,0 +1,42 @@
+__author__ = "Filipe G. Vieira"
+__copyright__ = "Copyright 2022, Filipe G. Vieira"
+__license__ = "MIT"
+
+import os
+import tempfile
+from pathlib import Path
+from snakemake.shell import shell
+from snakemake_wrapper_utils.java import get_java_opts
+
+extra = snakemake.params.get("extra", "")
+java_opts = get_java_opts(snakemake)
+log = snakemake.log_fmt_shell(stdout=True, stderr=True)
+
+n_out_files = len(snakemake.output)
+assert n_out_files > 1, "you need to specify more than 2 output files!"
+
+prefix = Path(os.path.commonprefix(snakemake.output))
+suffix = os.path.commonprefix([file[::-1] for file in snakemake.output])[::-1]
+chunk_labels = [
+    out.removeprefix(str(prefix)).removesuffix(suffix) for out in snakemake.output
+]
+assert all(
+    [chunk_label.isnumeric() for chunk_label in chunk_labels]
+), "all chunk labels have to be numeric!"
+len_chunk_labels = set([len(chunk_label) for chunk_label in chunk_labels])
+assert len(len_chunk_labels) == 1, "all chunk labels must have the same length!"
+
+with tempfile.TemporaryDirectory() as tmpdir:
+    shell(
+        "gatk --java-options '{java_opts}' SplitIntervals"
+        " --intervals {snakemake.input.intervals}"
+        " --reference {snakemake.input.ref}"
+        " --scatter-count {n_out_files}"
+        " {extra}"
+        " --tmp-dir {tmpdir}"
+        " --output {prefix.parent}"
+        " --interval-file-prefix {prefix.name:q}"
+        " --interval-file-num-digits {len_chunk_labels}"
+        " --extension {suffix:q}"
+        " {log}"
+    )

bio/gatk/splitncigarreads/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk SplitNCigarReads
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570487998491-SplitNCigarReads
 description: |
   Run gatk SplitNCigarReads.
 authors:
@@ -11,5 +12,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://software.broadinstitute.org/gatk/documentation/article?id=11050
-

bio/gatk/variantannotator/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk VariantAnnotator
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570271608219-VariantAnnotator
 description: |
   Run gatk VariantAnnotator.
 authors:
@@ -13,4 +14,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/4418054223003-VariantAnnotator

bio/gatk/varianteval/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk VariantEval
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570243836187-VariantEval-BETA-
 description: |
   Run gatk VariantEval.
 authors:
@@ -15,4 +16,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://gatk.broadinstitute.org/hc/en-us/articles/360056967892-VariantEval-BETA-

bio/gatk/variantfiltration/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk VariantFiltration
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570403488667-VariantFiltration
 description: |
   Run gatk VariantFiltration.
 authors:
@@ -13,4 +14,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://software.broadinstitute.org/gatk/documentation/article?id=11050

bio/gatk/variantrecalibrator/meta.yaml

@@ -1,4 +1,5 @@
 name: gatk VariantRecalibrator
+url: https://gatk.broadinstitute.org/hc/en-us/articles/9570466678811-VariantRecalibrator
 description: |
   Run gatk VariantRecalibrator.
 authors:
@@ -13,4 +14,3 @@ output:
 notes: |
   * The `java_opts` param allows for additional arguments to be passed to the java compiler, e.g. "-XX:ParallelGCThreads=10" (not for `-XmX` or `-Djava.io.tmpdir`, since they are handled automatically).
   * The `extra` param allows for additional program arguments.
-  * For more information see, https://software.broadinstitute.org/gatk/documentation/article?id=11050