feat: Pyroe make-spliced+intronic (#1288)

<!-- Ensure that the PR title follows conventional commit style (<type>:
<description>)-->
<!-- Possible types are here:
https://github.com/commitizen/conventional-commit-types/blob/master/index.json
-->

### Description

This PR add pyroe make-splice+intronic fasta for salmon alevin-fry
indexing.

### QC
<!-- Make sure that you can tick the boxes below. -->

* [X] I confirm that:

For all wrappers added by this PR, 

* there is a test case which covers any introduced changes,
* `input:` and `output:` file paths in the resulting rule can be changed
arbitrarily,
* either the wrapper can only use a single core, or the example rule
contains a `threads: x` statement with `x` being a reasonable default,
* rule names in the test case are in
[snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell
what the rule is about or match the tools purpose or name (e.g.,
`map_reads` for a step that maps reads),
* all `environment.yaml` specifications follow [the respective best
practices](https://stackoverflow.com/a/64594513/2352071),
* wherever possible, command line arguments are inferred and set
automatically (e.g. based on file extensions in `input:` or `output:`),
* all fields of the example rules in the `Snakefile`s and their entries
are explained via comments (`input:`/`output:`/`params:` etc.),
* `stderr` and/or `stdout` are logged correctly (`log:`), depending on
the wrapped tool,
* temporary files are either written to a unique hidden folder in the
working directory, or (better) stored where the Python function
`tempfile.gettempdir()` points to (see
[here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir);
this also means that using any Python `tempfile` default behavior
works),
* the `meta.yaml` contains a link to the documentation of the respective
tool or command,
* `Snakefile`s pass the linting (`snakemake --lint`),
* `Snakefile`s are formatted with
[snakefmt](https://github.com/snakemake/snakefmt),
* Python wrapper scripts are formatted with
[black](https://black.readthedocs.io).
* Conda environments use a minimal amount of channels, in recommended
ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as
conda-forge should have highest priority and defaults channels are
usually not needed because most packages are in conda-forge nowadays).

---------

Co-authored-by: tdayris <tdayris@gustaveroussy.fr>
Co-authored-by: tdayris <thibault.dayris@gustaveroussy.fr>
Co-authored-by: Johannes Köster <johannes.koester@uni-due.de>
Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com>
Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Co-authored-by: Felix Mölder <felix.moelder@uni-due.de>
Co-authored-by: Christopher Schröder <christopher.schroeder@tu-dortmund.de>

bio/pyroe/makesplicedintronic/environment.yaml

@@ -0,0 +1,7 @@
+channels:
+  - conda-forge
+  - bioconda
+  - nodefaults
+dependencies:
+  - pyroe=0.9.1
+  - bedtools=2.30.0

bio/pyroe/makesplicedintronic/meta.yaml

@@ -0,0 +1,18 @@
+name: pyroe make-spliced+intronic
+url: https://pyroe.readthedocs.io/en/latest/building_splici_index.html#preparing-a-spliced-intronic-transcriptome-reference
+description: >
+  Build splici reference files for Alevin-fry. The splici index reference of a given species consists of the transcriptome of the species, i.e., the spliced transcripts and the intronic sequences of the species.
+author:
+  - Thibault Dayris
+input:
+  - gtf: Path to the genome annotation (GTF formatted)
+  - fasta: Path to the genome sequence (Fasta formatted)
+  - spliced: Optional path to additional spliced sequences (Fasta formatted)
+  - unspliced: Optional path to unspliced sequences (Fasta formatted)
+output:
+  - fasta: Path to spliced+intronic sequences (Fasta formatted)
+  - gene_id_to_name: Path to a TSV formatted text file containing gene_id <-> gene_name correspondence
+  - t2g: Path to a TSV formatted text file containing the transcript_id <-> gene_name <-> splicing status correspondence
+params:
+  - read_length: The read length of the single-cell experiment being processed (determines flank size). Default is 100.
+  - extra: Optional parameters to be passed to pyroe

bio/pyroe/makesplicedintronic/test/Snakefile

@@ -0,0 +1,19 @@
+rule test_pyroe_makesplicedintronic:
+    input:
+        fasta="genome.fasta",
+        gtf="annotation.gtf",
+        spliced="extra_spliced.fasta",  # Optional path to additional spliced sequences (FASTA)
+        unspliced="extra_unspliced.fasta",  # Optional path to additional unspliced sequences (FASTA)
+    output:
+        fasta="splici_full/spliced_intronic_sequences.fasta",
+        gene_id_to_name="splici_full/gene_id_to_name.tsv",
+        t2g="splici_full/t2g.tsv",
+    threads: 1
+    log:
+        "logs/pyroe.log",
+    params:
+        read_length=91,  # Required
+        flank_trim_length=5,  # Optional l
+        extra="",  # Optional parameters
+    wrapper:
+        "master/bio/pyroe/makesplicedintronic"

bio/pyroe/makesplicedintronic/test/annotation.gtf

@@ -0,0 +1,27 @@
+##gff-version 2
+##source-version rtracklayer 1.52.1
+##date 2021-09-14
+chr1	rtracklayer	exon	1	2	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.1"; exon_id "E1"
+chr1	rtracklayer	exon	36	45	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.1"; exon_id "E2"
+chr1	rtracklayer	exon	71	80	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.1"; exon_id "E3"
+chr1	rtracklayer	exon	46	55	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.2"; exon_id "E4"
+chr1	rtracklayer	exon	91	100	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.2"; exon_id "E5"
+chr1	rtracklayer	exon	121	130	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.3"; exon_id "E6"
+chr1	rtracklayer	exon	156	160	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.3"; exon_id "E7"
+chr1	rtracklayer	exon	191	200	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.3"; exon_id "E8"
+chr1	rtracklayer	transcript	1	80	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.1";
+chr1	rtracklayer	transcript	46	100	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.2";
+chr1	rtracklayer	transcript	121	200	.	+	.	gene_id "g1"; gene_name "g1"; transcript_id "tx1.3";
+chr1	rtracklayer	gene	1	200	.	+	.	gene_id "g1"; gene_name "g1";
+chr2	rtracklayer	exon	1	2	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.1"; exon_id "E9"
+chr2	rtracklayer	exon	36	45	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.1"; exon_id "E10"
+chr2	rtracklayer	exon	71	80	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.1"; exon_id "E11"
+chr2	rtracklayer	exon	46	55	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.2"; exon_id "E12"
+chr2	rtracklayer	exon	91	100	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.2"; exon_id "E13"
+chr2	rtracklayer	exon	121	130	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.3"; exon_id "E14"
+chr2	rtracklayer	exon	156	160	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.3"; exon_id "E15"
+chr2	rtracklayer	exon	191	200	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.3"; exon_id "E16"
+chr2	rtracklayer	transcript	1	80	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.1";
+chr2	rtracklayer	transcript	46	100	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.2";
+chr2	rtracklayer	transcript	121	200	.	-	.	gene_id "g2"; gene_name "g2"; transcript_id "tx2.3";
+chr2	rtracklayer	gene	1	200	.	-	.	gene_id "g2"; gene_name "g2";

bio/pyroe/makesplicedintronic/test/extra_spliced.fasta

@@ -0,0 +1,2 @@
+>ExtraSpliced
+ATATATATATATATATATATATATATATATATATATATAT

bio/pyroe/makesplicedintronic/test/extra_unspliced.fasta

@@ -0,0 +1,2 @@
+>ExtraUnspliced
+CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCG

bio/pyroe/makesplicedintronic/test/genome.fasta

@@ -0,0 +1,8 @@
+>chr1
+TTAACATTCGCTGGGGGAGATGACGAGACTAGCCGCCGCGTGGTCCTGCCGCATTATACGTGTTCAAGCGCCTACGTGGG
+TTGGGCAACCCGTGCCTATGGAGGCATGGACAAATTAGGTTCAACTTCAGCTACGTACGAGACCTAGAGGTAATAAGGGT
+ATTTTACTCGGAGCATGTTTCAGTACGAACGTTAGATATC
+>chr2
+CTATCGAAGTGGAATCTTGAAGAGCCCATCGGTTAAGGTCTCTCCAATGTCCAGCCTATTCTATGGCACGGCAGACCCGT
+TGTGCATCCACAGTGATAACTTACTTGGGCTCTTAATAGAGGAGTGTTGCCATTTTATCGGCTTGCACTCCAATTAGCAC
+CAAGTGCCGTTATTGGGGTATTGCACTCATCAATAGCGTG

bio/pyroe/makesplicedintronic/test/genome.fasta.fai

@@ -0,0 +1,4 @@
+chr1
+	203	7	81	82
+chr2
+	203	220	81	82

bio/pyroe/makesplicedintronic/wrapper.py

@@ -0,0 +1,62 @@
+__author__ = "Thibault Dayris"
+__copyright__ = "Copyright 2023, Thibault Dayris"
+__email__ = "thibault.dayris@gustaveroussy.fr"
+__license__ = "MIT"
+
+
+from tempfile import TemporaryDirectory
+from snakemake.shell import shell
+
+
+log = snakemake.log_fmt_shell(stdout=True, stderr=True, append=True)
+extra = snakemake.params.get("extra", "")
+
+# pyroe uses the flank-length value to name its output files
+# in the result directory. We need this value to acquired output
+# files and let snakemake-wrapper choose its output file names.
+read_length = snakemake.params.get("read_length", 101)
+flank_trim_length = snakemake.params.get("flank_trim_length", 5)
+flank_length = read_length - flank_trim_length
+
+spliced = snakemake.input.get("spliced", "")
+if spliced:
+    spliced = "--extra-spliced " + spliced
+
+
+unspliced = snakemake.input.get("unspliced", "")
+if unspliced:
+    unspliced = "--extra-unspliced " + unspliced
+
+
+with TemporaryDirectory() as tempdir:
+    shell(
+        "pyroe make-spliced+intronic "
+        "{extra} {spliced} "
+        "{unspliced} "
+        "{snakemake.input.fasta} "
+        "{snakemake.input.gtf} "
+        "{read_length} "
+        "{tempdir} "
+        "{log}"
+    )
+
+    if snakemake.output.get("fasta", False):
+        shell(
+            "mv --verbose "
+            "{tempdir}/splici_fl{flank_length}.fa "
+            "{snakemake.output.fasta} {log}"
+        )
+
+    if snakemake.output.get("gene_id_to_name", False):
+        shell(
+            "mv --verbose "
+            "{tempdir}/gene_id_to_name.tsv "
+            "{snakemake.output.gene_id_to_name} {log}"
+        )
+
+    if snakemake.output.get("t2g", False):
+        shell(
+            "mv --verbose "
+            "{tempdir}/splici_fl{flank_length}_t2g_3col.tsv "
+            "{snakemake.output.t2g} {log} "
+        )

test.py

@@ -1185,6 +1185,21 @@ def test_art_profiler_illumina():
     )
 
 
+@skip_if_not_modified
+def test_pyroe_makesplicedintronic():
+    run(
+        "bio/pyroe/makesplicedintronic",
+        [
+            "snakemake",
+            "--cores",
+            "1",
+            "splici_full/spliced_intronic_sequences.fasta",
+            "--use-conda",
+            "-F",
+        ],
+    )
+
+
 @skip_if_not_modified
 def test_bcftools_filter_sample():
     run(