feat: barrnap-wrapper (#1448)

### Description
A wrapper for barrnap, a  bacterial ribosomal RNA predictor.

### QC

* [ ] I confirm that:

For all wrappers added by this PR, 

* there is a test case which covers any introduced changes,
* `input:` and `output:` file paths in the resulting rule can be changed
arbitrarily,
* either the wrapper can only use a single core, or the example rule
contains a `threads: x` statement with `x` being a reasonable default,
* rule names in the test case are in
[snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell
what the rule is about or match the tools purpose or name (e.g.,
`map_reads` for a step that maps reads),
* all `environment.yaml` specifications follow [the respective best
practices](https://stackoverflow.com/a/64594513/2352071),
* wherever possible, command line arguments are inferred and set
automatically (e.g. based on file extensions in `input:` or `output:`),
* all fields of the example rules in the `Snakefile`s and their entries
are explained via comments (`input:`/`output:`/`params:` etc.),
* `stderr` and/or `stdout` are logged correctly (`log:`), depending on
the wrapped tool,
* temporary files are either written to a unique hidden folder in the
working directory, or (better) stored where the Python function
`tempfile.gettempdir()` points to (see
[here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir);
this also means that using any Python `tempfile` default behavior
works),
* the `meta.yaml` contains a link to the documentation of the respective
tool or command,
* `Snakefile`s pass the linting (`snakemake --lint`),
* `Snakefile`s are formatted with
[snakefmt](https://github.com/snakemake/snakefmt),
* Python wrapper scripts are formatted with
[black](https://black.readthedocs.io).
* Conda environments use a minimal amount of channels, in recommended
ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as
conda-forge should have highest priority and defaults channels are
usually not needed because most packages are in conda-forge nowadays).

---------

Co-authored-by: Filipe G. Vieira <1151762+fgvieira@users.noreply.github.com>

bio/barrnap/environment.yaml

@@ -0,0 +1,5 @@
+channels:
+  - bioconda
+  - conda-forge
+dependencies:
+  - barrnap =0.9

bio/barrnap/meta.yaml

@@ -0,0 +1,14 @@
+name: barrnap
+description: BAsic Rapid Ribosomal RNA Predictor
+url: https://github.com/tseemann/barrnap
+authors:
+  - Curro Campuzano Jiménez
+input:
+  - fasta: query fasta file
+output:
+  - gff: The rRNA locations in GFF3 format. 
+  - fasta: Optional. Fasta file with the hit sequences.
+params:
+  - extra: additional parameters
+  - kingdom: database to use, either Bacteria:`bac`, Archaea:`arc`, Eukaryota:`euk` or Metazoan Mitochondria:`mito`.
+notes: Multiple threads can be used during nhmmer search.

bio/barrnap/test/Snakefile

@@ -0,0 +1,14 @@
+rule barrnap:
+    input:
+        fasta="{sample}.fasta",
+    output:
+        gff="{sample}.gff",
+        fasta="{sample}_hits.fasta",
+    params:
+        kingdom="bac",
+        extra="",
+    threads: 1
+    log:
+        "logs/barrnap/{sample}.log",
+    wrapper:
+        "master/bio/barrnap"

bio/barrnap/test/mitochondria.fasta

@@ -0,0 +1,22 @@
+>gi|13272612|gb|AF346967.1| Homo sapiens mitochondrion, fragment
+GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG
+GTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC
+CTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTAAAGTGTGTTA
+ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATC
+ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCC
+AAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCA
+CTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAAT
+ACAACCCCCGCCCATCCTACCCAGCACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCCA
+AAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCA
+CATCACCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAG
+CATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGCA
+ATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAA
+CGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGAT
+TAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTC
+ACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACACA
+CAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCA
+ACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCC
+CTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATAC
+CGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGTTAGGTCA
+AGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTATG
+AAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTGAGAGTAGAGTGCTTAGTTGAACAGGGCCCTGAA

bio/barrnap/wrapper.py

@@ -0,0 +1,27 @@
+"""Snakemake wrapper for barrnap."""
+
+__author__ = "Curro Campuzano Jiménez"
+__copyright__ = "Copyright 2023, Curro Campuzano Jiménez"
+__email__ = "campuzanocurro@gmail.com"
+__license__ = "MIT"
+
+
+from snakemake.shell import shell
+
+log = snakemake.log_fmt_shell(stdout=False, stderr=True)
+extra = snakemake.params.get("extra", "")
+kingdom = snakemake.params.get("kingdom", "bac")
+
+fasta_out = snakemake.output.get("fasta")
+if fasta_out:
+    extra += f" -o {fasta_out}"
+
+shell(
+    "barrnap"
+    " --threads {snakemake.threads}"
+    " -k {kingdom}"
+    " {extra}"
+    " < {snakemake.input.fasta}"
+    " > {snakemake.output.gff}"
+    " {log}"
+)

test.py

@@ -5606,7 +5606,6 @@ def test_bazam_separated():
         ],
     )
 
-
 @skip_if_not_modified
 def test_ragtag_correction():
     run(
@@ -5665,3 +5664,17 @@ def test_ragtag_merge():
             "-F",
         ],
     )
+
+@skip_if_not_modified
+def test_barrnap():
+    run(
+        "bio/barrnap",
+        [
+            "snakemake",
+            "--cores",
+            "1",
+            "mitochondria.gff",
+            "--use-conda",
+            "-F",
+        ],
+    )