feat: Salmon-Tximport meta-wrapper (#1270)

<!-- Ensure that the PR title follows conventional commit style (<type>:
<description>)-->
<!-- Possible types are here:
https://github.com/commitizen/conventional-commit-types/blob/master/index.json
-->

### Description

This PR includes the Salmon-Tximport meta-wrapper including the creation
of a decoy aware gentrome index.

### QC
<!-- Make sure that you can tick the boxes below. -->

(most of the points below do not concern meta-wrappers or are being
easily answered via the original wrappers themselves)

* [X] I confirm that:

For all wrappers added by this PR, 

* there is a test case which covers any introduced changes,
* `input:` and `output:` file paths in the resulting rule can be changed
arbitrarily,
* either the wrapper can only use a single core, or the example rule
contains a `threads: x` statement with `x` being a reasonable default,
* rule names in the test case are in
[snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell
what the rule is about or match the tools purpose or name (e.g.,
`map_reads` for a step that maps reads),
* all `environment.yaml` specifications follow [the respective best
practices](https://stackoverflow.com/a/64594513/2352071),
* wherever possible, command line arguments are inferred and set
automatically (e.g. based on file extensions in `input:` or `output:`),
* all fields of the example rules in the `Snakefile`s and their entries
are explained via comments (`input:`/`output:`/`params:` etc.),
* `stderr` and/or `stdout` are logged correctly (`log:`), depending on
the wrapped tool,
* temporary files are either written to a unique hidden folder in the
working directory, or (better) stored where the Python function
`tempfile.gettempdir()` points to (see
[here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir);
this also means that using any Python `tempfile` default behavior
works),
* the `meta.yaml` contains a link to the documentation of the respective
tool or command,
* `Snakefile`s pass the linting (`snakemake --lint`),
* `Snakefile`s are formatted with
[snakefmt](https://github.com/snakemake/snakefmt),
* Python wrapper scripts are formatted with
[black](https://black.readthedocs.io).
* Conda environments use a minimal amount of channels, in recommended
ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as
conda-forge should have highest priority and defaults channels are
usually not needed because most packages are in conda-forge nowadays).

---------

Co-authored-by: tdayris <tdayris@gustaveroussy.fr>
Co-authored-by: tdayris <thibault.dayris@gustaveroussy.fr>
Co-authored-by: Johannes Köster <johannes.koester@uni-due.de>
Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com>
Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Co-authored-by: Felix Mölder <felix.moelder@uni-due.de>
Co-authored-by: Christopher Schröder <christopher.schroeder@tu-dortmund.de>

meta/bio/salmon_tximport/meta.yaml

@@ -0,0 +1,16 @@
+name: Salmon Tximport
+url: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6178912.2/
+description: >
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Step           | Tool     | Reason                                                                                       |
+  +================+==========+==============================================================================================+
+  | Indexation     | Bash     | Identify decoy sequences                                                                     |
+  +                +----------+----------------------------------------------------------------------------------------------+
+  |                | Salmon   | Create decoy aware gentrome (genome + trancriptome) index                                    |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Quantification | Salmon   | Quantify sequenced reads                                                                     |
+  +                +----------+----------------------------------------------------------------------------------------------+
+  |                | Tximport | Import counts and inferential replicates in R as a ready-to-use SummarizedExperiment object. |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+authors:
+  - Thibault Dayris

meta/bio/salmon_tximport/test/Snakefile

@@ -0,0 +1,117 @@
+rule salmon_decoy_sequences:
+    input:
+        transcriptome="resources/transcriptome.fasta",
+        genome="resources/genome.fasta",
+    output:
+        gentrome=temp("resources/gentrome.fasta"),
+        decoys=temp("resources/decoys.txt"),
+    threads: 1
+    log:
+        "decoys.log",
+    wrapper:
+        "master/bio/salmon/decoys"
+
+
+rule salmon_index_gentrome:
+    input:
+        sequences="resources/gentrome.fasta",
+        decoys="resources/decoys.txt",
+    output:
+        multiext(
+            "salmon/transcriptome_index/",
+            "complete_ref_lens.bin",
+            "ctable.bin",
+            "ctg_offsets.bin",
+            "duplicate_clusters.tsv",
+            "info.json",
+            "mphf.bin",
+            "pos.bin",
+            "pre_indexing.log",
+            "rank.bin",
+            "refAccumLengths.bin",
+            "ref_indexing.log",
+            "reflengths.bin",
+            "refseq.bin",
+            "seq.bin",
+            "versionInfo.json",
+        ),
+    cache: True
+    log:
+        "logs/salmon/transcriptome_index.log",
+    threads: 2
+    params:
+        # optional parameters
+        extra="",
+    wrapper:
+        "master/bio/salmon/index"
+
+
+rule salmon_quant_reads:
+    input:
+        r="reads/{sample}.fastq.gz",
+        index=multiext(
+            "salmon/transcriptome_index/",
+            "complete_ref_lens.bin",
+            "ctable.bin",
+            "ctg_offsets.bin",
+            "duplicate_clusters.tsv",
+            "info.json",
+            "mphf.bin",
+            "pos.bin",
+            "pre_indexing.log",
+            "rank.bin",
+            "refAccumLengths.bin",
+            "ref_indexing.log",
+            "reflengths.bin",
+            "refseq.bin",
+            "seq.bin",
+            "versionInfo.json",
+        ),
+        gtf="resources/annotation.gtf",
+    output:
+        quant=temp("pseudo_mapping/{sample}/quant.sf"),
+        quant_gene=temp("pseudo_mapping/{sample}/quant.genes.sf"),
+        lib=temp("pseudo_mapping/{sample}/lib_format_counts.json"),
+        aux_info=temp(directory("pseudo_mapping/{sample}/aux_info")),
+        cmd_info=temp("pseudo_mapping/{sample}/cmd_info.json"),
+        libparams=temp(directory("pseudo_mapping/{sample}/libParams")),
+        logs=temp(directory("pseudo_mapping/{sample}/logs")),
+    log:
+        "logs/salmon/{sample}.log",
+    params:
+        # optional parameters
+        libtype="A",
+        extra="--numBootstraps 32",
+    threads: 2
+    wrapper:
+        "master/bio/salmon/quant"
+
+
+rule tximport:
+    input:
+        quant=expand(
+            "pseudo_mapping/{sample}/quant.sf", sample=["S1", "S2", "S3", "S4"]
+        ),
+        lib=expand(
+            "pseudo_mapping/{sample}/lib_format_counts.json",
+            sample=["S1", "S2", "S3", "S4"],
+        ),
+        aux_info=expand(
+            "pseudo_mapping/{sample}/aux_info", sample=["S1", "S2", "S3", "S4"]
+        ),
+        cmd_info=expand(
+            "pseudo_mapping/{sample}/cmd_info.json", sample=["S1", "S2", "S3", "S4"]
+        ),
+        libparams=expand(
+            "pseudo_mapping/{sample}/libParams", sample=["S1", "S2", "S3", "S4"]
+        ),
+        logs=expand("pseudo_mapping/{sample}/logs", sample=["S1", "S2", "S3", "S4"]),
+        tx_to_gene="resources/tx2gene.tsv",
+    output:
+        txi="tximport/SummarizedExperimentObject.RDS",
+    params:
+        extra="type='salmon'",
+    log:
+        "logs/tximport.log"
+    wrapper:
+        "master/bio/tximport"

meta/bio/salmon_tximport/test/resources/annotation.gtf

@@ -0,0 +1,11 @@
+#!genome-build ManuallyMadeForExample
+#!genome-version MMFE01
+#!genome-date 2023-04
+#!genome-build-accession NCBI:GCA_000001405.14
+#!genebuild-last-updated 2023-04
+chromosome1	manually_made	gene	160	208	.	+	.	gene_id "ENMG01"; gene_version "1"; gene_name "ManuallyMadeGene1"; gene_source "manually_made"; gene_biotype "protein_coding";
+chromosome1	manually_made	transcript	160	208	.	+	.	gene_id "ENMG01"; gene_version "1"; transcript_id "transcript1"; transcript_version "1"; gene_name "ManuallyMadeGene1"; gene_source "manually_made"; gene_biotype "protein_coding"; transcript_name "ENMT01"; transcript_source "manually_made"; transcript_biotype "processed_transcript"; tag "basic";
+chromosome1	manually_made	exon	160	208	.	+	.	gene_id "ENMG01"; gene_version "1"; transcript_id "transcript1"; transcript_version "1"; exon_number "1"; gene_name "ManuallyMadeGene1"; gene_source "manually_made"; gene_biotype "protein_coding"; transcript_name: "ENMT01"; transcript_source "manually_made"; transcript_biotype "processed_transcript"; tag "basic"; exon_id "ENEX01"; exon_version "1";
+chromosome1	manually_made	gene	160	240	.	+	.	gene_id "ENMG02"; gene_version "1"; gene_name "ManuallyMadeGene2"; gene_source "manually_made"; gene_biotype "protein_coding";
+chromosome1	manually_made	transcript	160	240	.	+	.	gene_id "ENMG02"; gene_version "1"; transcript_id "transcript2"; transcript_version "1"; gene_name "ManuallyMadeGene2"; gene_source "manually_made"; gene_biotype "protein_coding"; transcript_name "ENMT02"; transcript_source "manually_made"; transcript_biotype "processed_transcript"; tag "basic";
+chromosome1	manually_made	exon	160	240	.	+	.	gene_id "ENMG02"; gene_version "1"; transcript_id "transcript2"; transcript_version "1"; exon_number "1"; gene_name "ManuallyMadeGene2"; gene_source "manually_made"; gene_biotype "protein_coding"; transcript_name: "ENMT02"; transcript_source "manually_made"; transcript_biotype "processed_transcript"; tag "basic"; exon_id "ENEX02"; exon_version "1";

meta/bio/salmon_tximport/test/resources/genome.fasta

@@ -0,0 +1,13 @@
+>chromosome1
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNCTAGTAATACACGGATCTCCTCGGCGGAAGATTCCTACCGAAGCATCATCGTAACTTAATTACGTGATGTG
+CCAGGCTCGTATGTACATCGCTCCTCAAAGTGAGGGGAAGTCCTAATCGGATACCGATTGGACTCTTGAGTACCGGCCC
+TGTCGTACCGCTTCCCCCTTGAGCCGCTAGTAATCGATGCTCTACGAATAGGGCACCATCCTCGTTGTGCGCTACCACG
+GATTAGGCGCATCTCCCTGAGTCGGTTTAAAGATTGTTACCGTCCACCGTTGTCATATCAATATTATTAACAAGTTCGG
+TGGTAGGCATCTTATGGAAGGCTTACGGTTGCACCTTCCCTCAATCTCTTGCGACCATACTGTTATTCGGCGGGAACAC
+CGGTCTAACTGCGGTTAAGATAAGATTGCTAAGAATATTGTCGACTGGGATCCGGTTTATTATAGGATCTTCAGCTGTG
+GTTCCGCGACCACAACATCTAGCATGGGGGGCTCCGTGTGTTTCGAAGCGCCCATCATTTCGTAGCCACATATTGGAAT
+TAGCTGCCTTCAGAGTGATAATTAATCGCATAGGTAGGAGCACCCTCGTGAGGTCTTACTTGCCGGCCCGGTTTCATTC
+CAGAATCTGAGTTACCCGTGTTATGTCATGATCCTTGTATGCGTACTCTTGATAGGTAACCCGGAGTGCCCACCACGCA
+AGTTTATATAATCCCCGGGGAACAGGCTGTTGCCCAAAAGACTAGGCCCGTGTAGCTTTGCCCCGGATTCTCGTTAGTC
+GAGCGTTATGCTTTATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

meta/bio/salmon_tximport/test/resources/transcriptome.fasta

@@ -0,0 +1,4 @@
+>transcript1
+CCAGGCTCGTATGTACATCGCTCCTCAAAGTGAGGGGAAGTCCTAAT
+>transcript2
+CATCTCCCTGAGTCGGTTTAAAGATTGTCTTGTATGCGTACTCTTGATAGGTAACCCG

meta/bio/salmon_tximport/test/resources/tx2gene.tsv

@@ -0,0 +1,2 @@
+transcript1	ManuallyMadeGene1
+transcript2	ManuallyMadeGene2

meta/bio/salmon_tximport/used_wrappers.yaml

@@ -0,0 +1,5 @@
+wrappers:
+  - bio/salmon/decoys
+  - bio/salmon/index
+  - bio/salmon/quant
+  - bio/tximport

test.py

@@ -708,6 +708,20 @@ def test_open_cravat_module():
     )
 
 
+@skip_if_not_modified
+def test_salmon_tximport_meta():
+    run(
+        "meta/bio/salmon_tximport",
+        [
+            "snakemake",
+            "--cores",
+            "2",
+            "--use-conda",
+            "tximport/SummarizedExperimentObject.RDS",
+        ],
+    )
+
+
 @skip_if_not_modified
 def test_dada2_se_meta():
     run(