Fix CRISPRessoPooled error reporting #423
Merged
Conversation
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Fix bug in error reporting if duplicate names are present
Snicker7
added a commit
to edilytics/CRISPResso2
that referenced
this pull request
Apr 23, 2024
commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Apr 22 11:24:59 2024 -0600
Update CRISPRessoPooledCORE.py (#423)
Fix bug in error reporting if duplicate names are present
commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Apr 18 16:55:39 2024 -0600
Remove extra imports from CRISPRessoCore (#67) (#422)
commit 4aae57e5be475cd717792265bee36a71a99425de
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Apr 18 10:00:19 2024 -0600
Cole/refactor jinja undefined (#66) (#421)
* Replace Jinja2 PackageLoader with FileSystemLoader
The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
and Python 3.9. Replacing with FileSystemLoader work with the older version and
the latest version.
* Fix undefined variable `amplicon_name` in report template
* Refactor logging Jinja2 undefined variable warnings
* Revert plot_11a update
* Update intedration test branch
* Update jinja to warn on undefined but not fail. Fix all undefined warnings
* Fix github integration tests ref
* One more undefined variable
---------
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
Author: Cole Lyman <Cole@colelyman.com>
Date: Tue Apr 9 17:30:10 2024 -0600
Fix Jinja2 undefined variables (#63) (#417)
* Replace Jinja2 PackageLoader with FileSystemLoader
The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
and Python 3.9. Replacing with FileSystemLoader work with the older version and
the latest version.
* Fix undefined variable `amplicon_name` in report template
* Revert plot_11a update
* Update intedration test branch
* Update branch for integration tests
commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
Author: Han Dai <github@daihan.me>
Date: Fri Apr 5 18:36:41 2024 -0400
fix: change all U+00A0 to U+0020 (#400)
commit 235dc29c0cd0fcca2e999148d4660acf00b07221
Author: Cole Lyman <Cole@colelyman.com>
Date: Fri Apr 5 16:36:16 2024 -0600
Fastp, args as data, guardrails, and PE fix (#415)
* Change CRISPResso_status.txt format to JSON (#46)
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* add json read for status file
* changed Formatter to json format
* fixed json access variable name: message
* changed perentage_complete to numeric
* changed status file to .json
* Create integration_tests.yml
* Simplify name
* CRISPRESSO2_DIR environment variable
* Up one dir
* ls workspace
* Install CRISPResso and ydiff
* Clone repo instead of checkout
* submodule
* ls
* CRISPResso2_copy
* ls
* Update env
* Simplify
* Pull from githubactions branch
* Pull githubactions repo
* Checkout githubactions
* Run tests individually
* Pin plotly version
* Run all tests even if one fails
* Test on another branch
* Switch branch with token
* Update integration_tests.yml
* New makefile commands
* changed file to .json
* changed status to json file
* Make JSON human readable by adding new lines
* GitHub actions integration tests (#48)
* GitHub actions clean (#40)
* Create pytest.yml
* Create pylint.yml
* Create .pylintrc
* Create test_env.yml
* Full path
* Remove conda install
* Replace path
* Pytest tests
* pip -e
* Create integration_tests.yml
* Simplify name
* CRISPRESSO2_DIR environment variable
* Up one dir
* ls workspace
* Install CRISPResso and ydiff
* Clone repo instead of checkout
* submodule
* ls
* CRISPResso2_copy
* ls
* Update env
* Simplify
* Pull from githubactions branch
* Pull githubactions repo
* Checkout githubactions
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Run tests individually
* Pin plotly version
* Run all tests even if one fails
* Test on another branch
* Switch branch with token
* Update integration_tests.yml
* Introduce pandas sorting in CRISPRessoCompare (#47)
* New makefile commands
* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)
* Extract out split_interleaved_fastq function to CRISPRessoShared
* Implement splitting interleaved fastq files in CRISPRessoPooled
* Suppress split_interleaved_input from CRISPRessoWGS parameters
* Suppress other parameters in CRISPRessoWGS
* Move where interleaved fastq files are split to be trimmed properly
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* On push no branches
* On push no branches
* All in one file
* Fix yml errors
* Rename jobs
* Remove old workflow files
* Remove paths
* Run jobs in parallel
---------
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Move read filtering to after merging in CRISPResso (#39)
* Move read filtering to after merging
This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.
* Properly assign the correct file names for read filtering
* Add space around operators
* GitHub actions on pr (#51)
* Run integration tests on pull_request
* Run pytest on pull_request
* Run pylint on pull_request
* Run tests on PR only when opening PR (#53)
* Update reports (#52)
* Update report changes
* Switch branch of integration test repo
* Remove extraneous `crispresso_data_path`
* Point integration tests back to master
* point to test branch
* pointed CI config to testing branch
* Update integration_tests.yml
point to master
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
* Trevor/fastp integration (#50)
* Update check_program to check versions and create check_fastq function
* Update fastq arg, implement fastp in get_most_frequent_reads
* Bump version to 2.3.0
* Deprecate Flash and Trimmomatic parameters, and update fastp params
* Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap
* Implement trimming of single end reads
* Merge (and trim) reads in CRISPRessoCORE with fastp
* Modify error handling to account for fastp errors
* Replace flash and trimmomatic with fastp in Docker dependencies
* Update LICENSE.txt with fastp info
* Remove min and max amplicon length (no longer needed)
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Implement trimming with fastp in CRISPRessoPooled
* Implemend merging (and trimming) with fastp in CRISPRessoPooled
* Fixed minor fastp errors
* Move read filtering to after merging in CRISPResso (#39)
* Move read filtering to after merging
This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.
* Properly assign the correct file names for read filtering
* Add space around operators
* GitHub actions on pr (#51)
* Run integration tests on pull_request
* Run pytest on pull_request
* Run pylint on pull_request
* Run tests on PR only when opening PR (#53)
* Update reports (#52)
* Update report changes
* Switch branch of integration test repo
* Remove extraneous `crispresso_data_path`
* Point integration tests back to master
* Update where the test point to
* Fix 'Prime-edited' key not found (#32)
* Move 'Prime-edited' amplicon name check
By moving this, it will check if there is an amplicon named
'Prime-edited' (which is a reserved name) even if the
`prime_editing_pegRNA_extension_seq` parameter is empty.
* Only search for scaffold integration when pegRNA extension seq is provided
* Remove spaces at the end of lines
* Docker size (#49)
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* GitHub actions integration tests (#48)
* GitHub actions clean (#40)
* Create pytest.yml
* Create pylint.yml
* Create .pylintrc
* Create test_env.yml
* Full path
* Remove conda install
* Replace path
* Pytest tests
* pip -e
* Create integration_tests.yml
* Simplify name
* CRISPRESSO2_DIR environment variable
* Up one dir
* ls workspace
* Install CRISPResso and ydiff
* Clone repo instead of checkout
* submodule
* ls
* CRISPResso2_copy
* ls
* Update env
* Simplify
* Pull from githubactions branch
* Pull githubactions repo
* Checkout githubactions
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Run tests individually
* Pin plotly version
* Run all tests even if one fails
* Test on another branch
* Switch branch with token
* Update integration_tests.yml
* Introduce pandas sorting in CRISPRessoCompare (#47)
* New makefile commands
* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)
* Extract out split_interleaved_fastq function to CRISPRessoShared
* Implement splitting interleaved fastq files in CRISPRessoPooled
* Suppress split_interleaved_input from CRISPRessoWGS parameters
* Suppress other parameters in CRISPRessoWGS
* Move where interleaved fastq files are split to be trimmed properly
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* On push no branches
* On push no branches
* All in one file
* Fix yml errors
* Rename jobs
* Remove old workflow files
* Remove paths
* Run jobs in parallel
---------
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>
* 3.4->2.08
* Put ttf-mscorefonts-installer back above apt-get clean
* restore slash, replace fastp with trimmomatic and flash, add autoremove step
---------
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>
* initial readme modifications
* Updated readme to remove deprecated commands, updated help text to reflect new version and fastp
* Pointing test branch back at master
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
* Guardrails clean history (#34)
* Include guardrail functions
* Add CRISPRessoReports subtree
* Refactor to use CRISPRessoReports module
* Include guardrail functions
* Functional guardrails, needs reports update
* Add guardrail partial
* fix guardrials partial
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* GitHub actions integration tests (#48)
* GitHub actions clean (#40)
* Create pytest.yml
* Create pylint.yml
* Create .pylintrc
* Create test_env.yml
* Full path
* Remove conda install
* Replace path
* Pytest tests
* pip -e
* Create integration_tests.yml
* Simplify name
* CRISPRESSO2_DIR environment variable
* Up one dir
* ls workspace
* Install CRISPResso and ydiff
* Clone repo instead of checkout
* submodule
* ls
* CRISPResso2_copy
* ls
* Update env
* Simplify
* Pull from githubactions branch
* Pull githubactions repo
* Checkout githubactions
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Run tests individually
* Pin plotly version
* Run all tests even if one fails
* Test on another branch
* Switch branch with token
* Update integration_tests.yml
* Introduce pandas sorting in CRISPRessoCompare (#47)
* New makefile commands
* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)
* Extract out split_interleaved_fastq function to CRISPRessoShared
* Implement splitting interleaved fastq files in CRISPRessoPooled
* Suppress split_interleaved_input from CRISPRessoWGS parameters
* Suppress other parameters in CRISPRessoWGS
* Move where interleaved fastq files are split to be trimmed properly
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* On push no branches
* On push no branches
* All in one file
* Fix yml errors
* Rename jobs
* Remove old workflow files
* Remove paths
* Run jobs in parallel
---------
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Update C cythonized files
* Add exact numbers to guardrails printouts
* Remove extraneous whitespace from CRISPRessoCOREResources.pyx
* Fix calculation of `total_mods` from being negative
The issue was that `all_deletion_coordinates` just tells you how many deletions
were present, but not how long the deletion is.
* Changes to message
* Remove old tag
* Point tests at guardrails
* Restore C2 pro check
* Save message with guardrail name
* Point tests repo at master
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
* Fix case sensitivity in Prime Editing mode (#54)
* Move read filtering to after merging in CRISPResso (#39)
* Move read filtering to after merging
This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.
* Properly assign the correct file names for read filtering
* Add space around operators
* GitHub actions on pr (#51)
* Run integration tests on pull_request
* Run pytest on pull_request
* Run pylint on pull_request
* Run tests on PR only when opening PR (#53)
* Update reports (#52)
* Update report changes
* Switch branch of integration test repo
* Remove extraneous `crispresso_data_path`
* Point integration tests back to master
* Make all amplicons in amplicon_seq_arr uppercase
This fixes https://github.com/pinellolab/CRISPResso2/issues/396
* Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq
* Fix 'Prime-edited' key not found (#32)
* Move 'Prime-edited' amplicon name check
By moving this, it will check if there is an amplicon named
'Prime-edited' (which is a reserved name) even if the
`prime_editing_pegRNA_extension_seq` parameter is empty.
* Only search for scaffold integration when pegRNA extension seq is provided
* Remove spaces at the end of lines
* Docker size (#49)
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* GitHub actions integration tests (#48)
* GitHub actions clean (#40)
* Create pytest.yml
* Create pylint.yml
* Create .pylintrc
* Create test_env.yml
* Full path
* Remove conda install
* Replace path
* Pytest tests
* pip -e
* Create integration_tests.yml
* Simplify name
* CRISPRESSO2_DIR environment variable
* Up one dir
* ls workspace
* Install CRISPResso and ydiff
* Clone repo instead of checkout
* submodule
* ls
* CRISPResso2_copy
* ls
* Update env
* Simplify
* Pull from githubactions branch
* Pull githubactions repo
* Checkout githubactions
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Run tests individually
* Pin plotly version
* Run all tests even if one fails
* Test on another branch
* Switch branch with token
* Update integration_tests.yml
* Introduce pandas sorting in CRISPRessoCompare (#47)
* New makefile commands
* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)
* Extract out split_interleaved_fastq function to CRISPRessoShared
* Implement splitting interleaved fastq files in CRISPRessoPooled
* Suppress split_interleaved_input from CRISPRessoWGS parameters
* Suppress other parameters in CRISPRessoWGS
* Move where interleaved fastq files are split to be trimmed properly
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* On push no branches
* On push no branches
* All in one file
* Fix yml errors
* Rename jobs
* Remove old workflow files
* Remove paths
* Run jobs in parallel
---------
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>
* 3.4->2.08
* Put ttf-mscorefonts-installer back above apt-get clean
* restore slash, replace fastp with trimmomatic and flash, add autoremove step
---------
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Guardrails clean history (#34)
* Include guardrail functions
* Add CRISPRessoReports subtree
* Refactor to use CRISPRessoReports module
* Include guardrail functions
* Functional guardrails, needs reports update
* Add guardrail partial
* fix guardrials partial
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* GitHub actions integration tests (#48)
* GitHub actions clean (#40)
* Create pytest.yml
* Create pylint.yml
* Create .pylintrc
* Create test_env.yml
* Full path
* Remove conda install
* Replace path
* Pytest tests
* pip -e
* Create integration_tests.yml
* Simplify name
* CRISPRESSO2_DIR environment variable
* Up one dir
* ls workspace
* Install CRISPResso and ydiff
* Clone repo instead of checkout
* submodule
* ls
* CRISPResso2_copy
* ls
* Update env
* Simplify
* Pull from githubactions branch
* Pull githubactions repo
* Checkout githubactions
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Run tests individually
* Pin plotly version
* Run all tests even if one fails
* Test on another branch
* Switch branch with token
* Update integration_tests.yml
* Introduce pandas sorting in CRISPRessoCompare (#47)
* New makefile commands
* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)
* Extract out split_interleaved_fastq function to CRISPRessoShared
* Implement splitting interleaved fastq files in CRISPRessoPooled
* Suppress split_interleaved_input from CRISPRessoWGS parameters
* Suppress other parameters in CRISPRessoWGS
* Move where interleaved fastq files are split to be trimmed properly
* Bug Fix - 367 (#35)
* - Fixed references to ref_names_for_pe
* removed extra tabs
* trying to match empty line, no tabs
* - changed references to ref_names[0]
* Mckay/pd warnings (#45)
* refactor errors='ignore' to try except
* refactored integer slice to iloc[]
* moved to_numeric try except to function
* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns
This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.
* Add documentation to to_numeric_ignore_columns
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
* On push no branches
* On push no branches
* All in one file
* Fix yml errors
* Rename jobs
* Remove old workflow files
* Remove paths
* Run jobs in parallel
---------
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>
* Update C cythonized files
* Add exact numbers to guardrails printouts
* Remove extraneous whitespace from CRISPRessoCOREResources.pyx
* Fix calculation of `total_mods` from being negative
The issue was that `all_deletion_coordinates` just tells you how many deletions
were present, but not how long the deletion is.
* Changes to message
* Remove old tag
* Point tests at guardrails
* Restore C2 pro check
* Save message with guardrail name
* Point tests repo at master
---------
Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
---------
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: trevormartinj7 <trevormartinj7@gmail.com>
* Batch d3 clean (#55)
* imports C2Pro plots if available
* added --use_matplotlib flag
* added C2Pro
matched api funciton signatures
* added api args for plotly
* added **kwargs
* renamed config to custom_config, more specificity
* added backend flag for plotly kaleido
* added pro_installed boolean for templates, added plotly dependency to report templates
* Squashed commit of the following:
commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954
Author: McKay <mbowcut@gmail.com>
Date: Thu Feb 15 15:55:23 2024 -0700
added plotly dependency for pro
commit 76b3601f6a0144f100266153f1c999e0c5de65de
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Jan 12 09:56:19 2024 -0700
Squashed commit of the following:
commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Jan 12 09:48:20 2024 -0700
fix guardrials partial
commit 22fc03183a8070c30dfb74d5c23575ac19019855
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Jan 12 08:54:01 2024 -0700
Add guardrail partial
commit e55f6b21972b578261bc5a864ce1d653d98f9e34
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Mon Jan 8 07:50:59 2024 -0700
Functional guardrails, needs reports update
commit 6e968e9699ed59a47d88191d03768e042d8b60a4
Merge: 32b49685 e948ce10
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Mon Dec 18 13:34:36 2023 -0700
Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history
commit 32b49685da320501dad2b0ebbb57887b66220ba8
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Dec 15 15:27:04 2023 -0700
Include guardrail functions
commit 4e309cf6f732565d635de3d4c5d074ada3027e2d
Author: Cole Lyman <cole@colelyman.com>
Date: Mon Dec 18 10:51:55 2023 -0700
Refactor to use CRISPRessoReports module
commit e648dc087c0055bc5d2fca13c64071a371dea941
Author: Cole Lyman <cole@colelyman.com>
Date: Mon Dec 18 10:51:11 2023 -0700
Add CRISPRessoReports subtree
commit e948ce107ebb0d1d99010ed12e937f34b5e607d4
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Dec 15 15:27:04 2023 -0700
Include guardrail functions
commit d33c748871a625facfe8d792e29c77ab9779138f
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Nov 7 16:31:06 2023 -0700
Include parameter --assign_ambiguous_alignments_to_first_reference in readme
commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed Oct 11 17:17:30 2023 -0600
Enable quantification by sgRNA (#348)
This PR includes:
- storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs']
- a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately.
I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command:
```
CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table -n hdr3 -p max -gn guide1,guide2
```
```
python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3
```
This produces:
```
Processed 25000 alleles
Reference: Reference (2391/23415 modified reads)
UNMODIFIED: 21024
MODIFIED guide1: 2359
MODIFIED guide2: 32
Reference: HDR (856/1577 modified reads)
UNMODIFIED: 721
MODIFIED guide1: 854
MODIFIED guide1 + guide2: 1
MODIFIED guide2: 1
```
commit 2e3da02fdbed2fa8ae02a277763d65a502459827
Author: Cole Lyman <Cole@colelyman.com>
Date: Tue Oct 10 15:29:08 2023 -0600
changed tuple to list for matplotlib change (#31) (#346)
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
commit cd3c332135fe4db0f9218e3d87263d5c65838ed9
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sun Oct 1 01:54:46 2023 -0600
rename script to camel case
commit 7c719d65fb36ac7654db9040f226564ea28fcab9
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sun Oct 1 01:53:44 2023 -0600
Add new script for counting high quality bases
commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Sep 14 15:15:30 2023 -0600
Prime editing alignment params (#336)
Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty.
CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences.
The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs.
commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Sep 7 16:43:30 2023 -0600
Fix samtools piping (#325)
* Remove samtools pipe stderr to stdout
Sometimes some of the libraries that samtools depends on don't have the correct
version information, and as such samtools will report this to stderr when run.
Because we pipe the output of samtools, we expect it to be valid SAM format, but
when these library version messages are reported, it breaks CRISPRessoWGS.
* Remove extra spacing at end of lines and add missing comma in WGS
* Log stderr from samtools in CRISPRessoWGS
commit 8feff4101f27406d9d88ace97d31a518276bff3f
Author: Cole Lyman <Cole@colelyman.com>
Date: Fri Sep 1 09:43:56 2023 -0600
Replace link to CRISPResso schematic with raw URL in README (#329)
* Replace link to CRISPResso schematic with raw URL
* Add new lines to the beginning of unordered lists
commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 10 00:52:12 2023 -0600
Try to unbreak CircleCI
commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 10 00:17:27 2023 -0600
Center command line text messages
commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 10 00:17:07 2023 -0600
Fix bug in prime-editing scaffold-incorporation plotting
If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read.
commit 2b36a1a5c35e8a93516ce8baf464595615e0f402
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed Aug 9 15:29:48 2023 -0600
CRISPRessoPooled --compile_postrun_references bug fixes
commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Aug 8 23:30:15 2023 -0600
Fix missing ' in Pooled --demultiplex_only_at_amplicons
commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664
Author: Cole Lyman <Cole@colelyman.com>
Date: Mon Jul 24 10:47:46 2023 -0600
Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316)
* Make sorting stable
* Including c files
* Sort by #Reads instead of %Reads to avoid floating point errors
---------
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit de05533b3511a84f3b6b14fc2ef64db041613261
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Jul 6 13:54:45 2023 -0600
Fix multiprocessing lambda pickling (#311)
* Fix running plots in parallel
The reason the plots were running slower before this change is because I was
calling the plot function, not passing it to `submit`. So it was essentially
running in serial, but worse because it was still spinning up/down the
processes.
* Fix multiprocessing lambda pickling (#20)
* Refactor process_futures to be a dict
This makes debugging much easier because you can associate the arguments to the
future with the results.
* Fix the pickling error when running in multiprocessing
Only top-level functions (not lambdas) can be pickled to use in multiprocessing
pools, thus the lambdas are converted to a regular function.
* Further fixes to pickling multiprocessing error (#21)
* Refactor process_futures to be a dict
This makes debugging much easier because you can associate the arguments to the
future with the results.
* Fix the pickling error when running in multiprocessing
Only top-level functions (not lambdas) can be pickled to use in multiprocessing
pools, thus the lambdas are converted to a regular function.
* Use Counter instead of defaultdict in CRISPRessoCORE
* Update process_futures to dict in Batch and Aggregate
commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jul 3 17:12:09 2023 -0600
Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append
commit 7285da0e987b77b72c8885bb35940e0f50c146bd
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Fri Jun 23 16:50:33 2023 -0600
Fix print bug for invalid fastq
commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Jun 21 16:03:48 2023 -0600
Slugify before creating filename - replaces invalid characters in batch names with _
commit f97e29c67de4c80b8d6b9cf334f363be4b514ade
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed Jun 21 14:43:43 2023 -0600
Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307)
* Add verbosity argument to CRISPRessoAggregate (#18)
* Allow for amplicon and guide seqs to be some variant of NA in batch (#19)
This was discovered when attempting to infer amplicon sequences in batch mode on
the web interface, NAs were supplied for the amplicon sequences to the sub
CRISPResso commands.
commit 32e1e9797da5c3033cdc588e92f06b8813961953
Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu>
Date: Wed Jun 21 14:01:00 2023 -0600
Allow for interrogation of overlapping sgRNA sites
commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jun 12 12:16:47 2023 -0600
Check input fastq file format
Asserts input format of fastq files - including if gzipped files are missing the gz suffix.
commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jun 5 13:41:55 2023 -0600
Fix CRISPRessoArgParser
commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jun 5 13:29:31 2023 -0600
Cosmetic updates for command-line use
- version bump to 2.2.13
- If no args are provided, the command line version will print out an abbreviated help message
- parameters can be excluded from CRISPRessoArgParser
commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu May 11 14:31:47 2023 -0600
Fix multiprocessing error, don't start pool when only using single thread (#302)
* Update README to have consistent use of `--base_editor_output` (#16)
* Add files via upload
* Only start process pools when using multiple processes
This is mainly to solve the issue when running on AWS Lambda, but this should
improve single core performance overall.
---------
Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>
commit 92a705c939b370373a70cf6ae9f1616de33288b9
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu May 11 14:31:06 2023 -0600
Update `base_editor` parameters in README and add Plot Harness (#301)
* Update README to have consistent use of `--base_editor_output` (#16)
* Add files via upload
---------
Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>
commit 7d46c4490235df45c5546b1b470e4e6a99727031
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed May 10 15:41:33 2023 -0600
Clarify CRISPRessoWGS intended use (#303)
* Update README to have consistent use of `--base_editor_output` (#16)
* Add sample plotting jupyter notebook
* Add clarifying info to CRISPRessoWGS description
Clarify WGS usage
commit 833a701787bb47674b3e921c38cac6189c775cf7
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 4 17:02:46 2023 -0400
Remove debug print statements
commit 712eb2a11825e8d36f2870deb12b35486bd633fb
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 4 16:40:07 2023 -0400
Allow dashes in filenames resolve #73
commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sat Apr 22 23:41:58 2023 -0400
Raise exceptions from within futures in plot_pool
commit 7e807a60de2a9d18bccd034b87106ceaf7153338
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sat Apr 22 23:38:56 2023 -0400
Fix future pandas indexing warning
Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead"
commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Apr 20 13:59:27 2023 -0600
Remove debug print statements fixes #295 (#297)
The format string option used here is only available in Python version >=3.8.
commit 478c06f784603e96d20f96e91993fdcc4ac35c8a
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Apr 13 12:09:26 2023 -0400
Update plotCustomAllelePlot.py script for #292 (#293)
Update type of 'max_rows' param to int
Fix location of 'args' in crispresso2_info object
commit bcdae39e05d530f4a4e78738c3b30f7664981919
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Mar 27 13:18:34 2023 -0400
Update pooled parameter format
commit 546446e36e7e68b527767d6c31ec341a49df2059
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Feb 14 16:26:23 2023 -0500
Fix running plots in parallel (#286)
The reason the plots were running slower before this change is because I was
calling the plot function, not passing it to `submit`. So it was essentially
running in serial, but worse because it was still spinning up/down the
processes.
Co-authored-by: Cole Lyman <cole@colelyman.com>
commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1
Author: kclem <k.clement.dev@gmail.com>
Date: Fri Feb 10 15:45:15 2023 -0500
Fix #283 to avoid filename collisions
Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29
commit e577318006cd17b2725bd028e5e56634c6eb829a
Author: kclem <k.clement.dev@gmail.com>
Date: Mon Feb 6 16:37:25 2023 -0500
Case-insensitive headers accepted in CRISPRessoPooled
commit d34927620a4a6126a9988b3041e76f60728abbfe
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Jan 31 13:48:33 2023 -0500
Fix print statement in CORE
commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Jan 31 13:22:51 2023 -0500
Version bump to 2.2.12
commit 1d4679c72d0c8b4154317c9aff5179217198e2d7
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Jan 31 13:01:31 2023 -0500
Status Updates + Pooled Mixed Mode Update (#279)
* Implement logging handler to overwrite the latest log status to file
* Add StatusHandler to CRISPRessoCORE log
This will take the latest log output and write it to a file (`status.txt`), the
catch being that with each log the file is overwritten so that one can easily
tell where CRISPResso currently is and what the error is (if any). These changes
include some slight refactoring in order to accomodate any potential parameter
exceptions.
* Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn`
* Add StatusHandler to CRISPRessoPooled and a little refactoring
* Implement `percent_complete` to the status log
* Add StatusHandler to CRISPRessoAggregate log
* Add StatusHandler to CRISPRessoCompare log
* Add StatusHandler to CRISPRessoPooledWGSCompare log
* Add StatusHandler to CRISPRessoWGS log
* Rename `status.txt` to `CRISPResso_status.txt`
* Modify status log names to match the tool they are generated from
* Add percent_complete stages to CRISPRessoCORE
These also include log statements of each plot that is being generated as well
as fixing some variable name collisions with `ind`.
* Format the percentage in the log to be 2 decimal places
* Change all plotting logs from `info` to `debug` and simplify progress
This refactors how the progress of the plots is calculated, making it much
simplier. Before this change we would of had to keep track of the number of
times `percent_complete` was output, but now it simply updates the percent
complete after each amplicon is finished processing. Hopefully this will make
things easier to mantain even though it will be a little less "accurate" (not
sure how accurate the original implementation was...).
* Implemented shared console log handler across all CRISPResso* calls
This allows for easy changes to logging formatting, which was inspired by having
to change the default logging level. The default logging level needs to be set
at `logging.DEBUG` in order for the debug log statements to not be ignored for
the running and status logs.
* Add ability to set the verbosity level to each CRISPResso* tool
This allows users to set a verbosity level between 1 and 4 using the
`-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the
level will default to 4, being the most verbose.
* Implement showing the last seen `percent_compelte` when none is provided
* Keep track of and log when multiple parallel runs are completed
These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that
we can now display when a run is completed. This potentially breaks how
signals and interupts are handled with multiple runs happening, but this needs
to be reviewed.
* Add debug and percentage complete to CRISPRessoBatch
* Add percent complete to CRISPRessoPooled
* Add debug and percent_complete message to CRISPRessoAggregate
* Add `percent_complete` to CRISPRessoCompare
* Add `percent_complete` to CRISPRessoPooledWGSCompare
* Add status and `percent_complete` to CRISPRessoMeta
* Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare
* Fixing documentation to match pooled headers
* Header removal bug fix change documentation to guide_seq
* Update documentation and help feature for CRISPRessoPooled
* Remove extra newlines from CRISPRessoPooled -h
* Make variable names as clear as my firstborn child's name
* Update one more variable name
* Fix bug to flow CRISPRessoPooled options to sub command
* Make amplicon file args variable name clear
* Update how parameters are set and retrieved from parameter object
The refactor in the previous commit changed the type of the arguments to a
dictionary which doesn't have the parameters as attributes, and this commit
fixes that error.
* Add note in output header for change in default CRISPRessoPooled
In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the
default when running in mixed-mode. This is to allow for inexact alignments of
the reads and the amplicons to the genome. For more context, see this issue
https://github.com/pinellolab/CRISPResso2/issues/276
* Clarify the verbosity parameter help message
* Separate out parameters to `normalize_name` in CRISPRessoCORE
* Separate out parameters to `normalize_name` in CRISPRessoWGS
* Separate out parameters to `normalize_name` in CRISPRessoPooled
* Separate out parameters to `normalize_name` in CRISPRessoCompare
* Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name`
* Refactor `run_crispresso_cmds` to not require a `logger`
This commit implements the functionality to make the `logger` object optional by
seeing which module called the `run_crispresso_cmds` function and obtaining the
correct object from that module name.
The function also immediately returns when no commands are passed to it.
* Add amplicon name to plotting debug statements in CRISPRessoCORE
---------
Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local>
Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jan 26 15:27:27 2023 -0500
CRISPRessoPooled custom header fix (#278)
* Fixing documentation to match pooled headers
* Header removal bug fix change documentation to guide_seq
* Update documentation and help feature for CRISPRessoPooled
* Remove extra newlines from CRISPRessoPooled -h
* Make variable names as clear as my firstborn child's name
* Update one more variable name
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit 104866e1080c973bb025d1a5ba59b19dca1658af
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Jan 5 14:00:26 2023 -0700
Fix deprecated numpy type names (fixes #269) (#270)
In the most recent version of numpy (1.24) some of the types have been
deprecated. This commit fixes these errors.
commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Jan 5 06:49:35 2023 -0700
Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274)
I have suffered enough trying to debug my installation, so hopefully this helps
someone else.
Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
commit b9851e98104602eb78c2b384105267624295e9d3
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Dec 22 13:30:23 2022 -0700
Fix bug when pooled bam is input (#265)
This change checks to see if a bam file was input, and if so it doesn't try to
remove any intermediate files because there aren't any.
Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
commit b822612642043e75a19042941f69b457ce51f517
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Dec 19 15:26:45 2022 -0500
Delete vscode settings
commit b99aa624dec68ef7d19264340ce0cafa829625f4
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Dec 19 13:29:14 2022 -0500
Clarify input param help for pooled bam
commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Dec 19 13:28:54 2022 -0500
Fix #235 - Cigar string is * if read unaligned
Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235.
commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Dec 8 13:48:17 2022 -0700
Add deprecation notice (#260)
* Add FLASh and Trimmomatic deprecation notice to CLI output
* Add Edilytics email address to CLI output
commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Dec 6 12:16:19 2022 -0500
Format filterReadsOnSequencePresence script
commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Fri Dec 2 22:12:54 2022 -0500
Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string
commit 9ddea40f7f02b546941ddaa4c71fc5283075051a
Author: kclem <k.clement.dev@gmail.com>
Date: Mon Nov 14 10:33:04 2022 -0500
Add check for prime editing extension sequence in prime edited sequence
if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence.
commit 152f2dd5001da7090641ee8a1326bde9f7e8104e
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Nov 9 11:53:41 2022 -0500
Version bump to 2.2.11a
commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Nov 9 11:47:30 2022 -0500
Add param to override prime editing sequence checks
CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.'
commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Nov 9 10:06:51 2022 -0500
Update filterReadsOnSequencePresence.py
commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Nov 7 22:25:16 2022 -0500
Add script to filter input based on sequence presence
commit 713e57a19c35180035ca35e11a5820065eda0198
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Oct 18 16:02:26 2022 -0400
Allow spaces in read names for CRISPRessoWGS
commit 39ce008bdddccdd8229c0ba185dce78bc2f66968
Author: Cole Lyman <Cole@colelyman.com>
Date: Sat Oct 8 21:09:58 2022 -0600
Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250)
commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sat Oct 8 23:08:47 2022 -0400
Batch amplicon plots (#251)
* Error out if HDR amplicon matches existing amplicon
* Add check for amplicon sequence uniqueness
* Fix bug with bam_input not having bam_output
* Test for no returned lines in auto mode, version bump to 2.2.11
* Fix pandas deprecation of df.append
commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Oct 6 16:32:02 2022 -0400
Fix CRISPRessoBatch plot pool bug when plots are suppressed
commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed Sep 21 21:04:51 2022 -0600
Fix batch quilt plot name (#249)
This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch.
commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Sep 15 15:49:08 2022 -0400
Version bump to 2.2.10
commit c5f79aebfc1ae209f4ee320df250eed89a02787c
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed Sep 14 14:24:55 2022 -0600
Parallel plot refactor (#247)
* Fix duplicate plotting in CRISPRessoBatch aggregate
* Refactor mulltiprocessing plots in CRISPRessoBatch
* Refactor multiprocessing plots in CRISPRessoCORE
* Refactor multiprocessing plots for CRISPRessoAggregate
commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Sep 13 14:12:11 2022 -0400
print files in curr dir if Aggregate can't find files
commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Sep 12 10:32:57 2022 -0400
Spelling typo
commit c15f01c75083403f17c58c121b2afe97e9f2a1ec
…
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
Fix bug in error reporting if duplicate names are present