sam_subseq
takes two inputs:
- SAM file with reads (or sequences in general) aligned to one or more references
- GFF file defining features for the reference(s)
sam_subseq
will project the GFF coordinates (which refer to the reference)
onto the reads, extract subsequences corresponding to the GFF features (with
deletion, insertions, truncations, etc.), and output these subsequences in
FASTA format.
pip install sam_subseq
$ sam_subseq -h
usage: sam_subseq [-h] --gff GFF [infile] [outfile]
Extract features (subsequences) from aligned reads in a SAM file,
using annotations for the reference sequence.
sam_subseq parses the CIGAR string to determine which part of the
read sequence (the query) to output.
The SAM file must be sorted by coordinate (default for samtools sort)!
Example:
80 180 290
|---CDS----|
|----exon------------|
REF: -------------------------------
QRY: xxxxxxxxxxyyyyyyy--z
The reference has an exon annotation from position 80-290.
Extracting this feature from the query will yield: xxxxxxxxxxyyyyyyyz
The CDS in the query shows a deletion and is incompletely represented.
Extracting the CDS from 180-290 will yield yyyyyyyz.
Some information from the gff file is written into the header of each
output sequence. Coordinates conform to Python conventions, ie.
zero-based and end-exclusive.
These fields are of the form 'label=value;'. Currently, the following
information is output:
- the original sequence header
- qry_start: The start coordinate of the extracted feature in the
query (ie. aligned, non-reference sequence)
- qry_stop: The end coordinate of the extracted feature in the query
- qry_len: The length of the extracted feature in the query
The length can be zero, for example if a feature spans positions
50-100, but the alignment of the query spans only positions 10-40
- gff_id: The ID of the gff record
- gff_type: The type of the gff record
- gff_start: The start coordinate as defined in the GFF (ie. for the
reference)
- gff_end: The end coordinate as defined in the GFF
- gff_phase: The phase as defined in the GFF
- gff_name: If a 'Name' annotation is present in the GFF attribute
field, it is output. If it is not available, this is set to NA.
The output is a FASTA file with one extracted feature per record.
positional arguments:
infile Input file (.sam). Default: stdin
outfile Output file (.fasta) Default: stdout
options:
-h, --help show this help message and exit
--gff GFF GFF files with features to extract. GFF SEQIDs (field 1) must correspond to SAM RNAMEs (field 1), or they will not be found.
SAM input
@HD VN:1.6 SO:coordinate
@SQ SN:ref1 LN:67
@SQ SN:ref2 LN:67
@PG ID:minimap2 PN:minimap2 VN:2.26-r1175 CL:minimap2 -a -s1 -m1 -w1 -E1,0 refs.fa queries.fa
@PG ID:samtools PN:samtools PP:minimap2 VN:1.17 CL:samtools sort -O sam
qry1 0 ref1 1 60 67M * 0 0 ATCGAGTCGTAGCAGGCTGAGCGATGCGAGGCAGCGACGGACGAGTAGCAGCTAAAGCTAAGGAGCA * NM:i:0 ms:i:134 AS:i:134 nn:i:0 tp:A:P cm:i:53 s1:i:67 s2:i:0 de:f:0 rl:i:0
qry3 0 ref1 1 46 25M19D23M * 0 0 ATCGAGTCGTAGCAGGCTGAGCGATGTAGCAGCTAAAGCTAAGGAGCA * NM:i:19 ms:i:88 AS:i:73 nn:i:0 tp:A:P cm:i:21 s1:i:44 s2:i:0 de:f:0.0204 rl:i:0
qry2 0 ref1 33 48 35M * 0 0 AGCGACGGACGAGTAGCAGCTAAAGCTAAGGAGCA * NM:i:0 ms:i:70 AS:i:70 nn:i:0 tp:A:P cm:i:21 s1:i:35 s2:i:0 de:f:0 rl:i:0
qry4 0 ref2 29 55 39M * 0 0 GAGCTGATGCACGACACGACGATCGATCGACTGTATGTA * NM:i:0 ms:i:78 AS:i:78 nn:i:0 tp:A:P cm:i:25 s1:i:39 s2:i:0 de:f:0 rl:i:0
Alignment
<< Alignments to ref1 >>
1 11 21 31 41 51 61
ATCGAGTCGTAGCAGGCTGAGCGATGCGAGGCAGCGACGGACGAGTAGCAGCTAAAGCTAAGGAGCA
...................................................................
.........................*******************.......................
...................................
<< Alignments to ref2 >>
1 11 21 31 41 51 61
ACGACGTACGTAGCGAACGACGATCGACGAGCTGATGCACGACACGACGATCGATCGACTGTATGTA
.......................................
GFF input
##gff-version 3
##sequence-region ref1 1 67
ref1 . gene 1 67 . + . ID=ref1
ref1 . exon 10 62 . + . ID=ref1:exon;=ref1-exon;Parent=ref1
ref1 . CDS 20 62 . + 0 ID=ref1:CDS;Name=ref1-cds;Parent=ref1
##sequence-region ref2 1 67
ref2 . gene 1 67 . + . ID=ref2
ref2 . exon 10 62 . + . ID=ref2:exon;=ref2-exon;Parent=ref2
ref2 . CDS 20 62 . + 0 ID=ref2:CDS;Name=ref2-cds;Parent=ref2
FASTA output
>qry1;qry_start=0;qry_stop=67;qry_len=67;gff_id=ref1;gff_type=gene;gff_start=0;gff_end=67;gff_phase=.;gff_name=NA
ATCGAGTCGTAGCAGGCTGAGCGATGCGAGGCAGCGACGGACGAGTAGCAGCTAAAGCTAAGGAGCA
>qry1;qry_start=9;qry_stop=62;qry_len=53;gff_id=ref1;gff_type=exon;gff_start=9;gff_end=62;gff_phase=.;gff_name=NA
TAGCAGGCTGAGCGATGCGAGGCAGCGACGGACGAGTAGCAGCTAAAGCTAAG
>qry1;qry_start=19;qry_stop=62;qry_len=43;gff_id=ref1;gff_type=CDS;gff_start=19;gff_end=62;gff_phase=0;gff_name=ref1-cds
AGCGATGCGAGGCAGCGACGGACGAGTAGCAGCTAAAGCTAAG
>qry3;qry_start=0;qry_stop=48;qry_len=48;gff_id=ref1;gff_type=gene;gff_start=0;gff_end=67;gff_phase=.;gff_name=NA
ATCGAGTCGTAGCAGGCTGAGCGATGTAGCAGCTAAAGCTAAGGAGCA
>qry3;qry_start=9;qry_stop=43;qry_len=34;gff_id=ref1;gff_type=exon;gff_start=9;gff_end=62;gff_phase=.;gff_name=NA
TAGCAGGCTGAGCGATGTAGCAGCTAAAGCTAAG
>qry3;qry_start=19;qry_stop=43;qry_len=24;gff_id=ref1;gff_type=CDS;gff_start=19;gff_end=62;gff_phase=0;gff_name=ref1-cds
AGCGATGTAGCAGCTAAAGCTAAG
>qry2;qry_start=0;qry_stop=35;qry_len=35;gff_id=ref1;gff_type=gene;gff_start=0;gff_end=67;gff_phase=.;gff_name=NA
AGCGACGGACGAGTAGCAGCTAAAGCTAAGGAGCA
>qry2;qry_start=0;qry_stop=30;qry_len=30;gff_id=ref1;gff_type=exon;gff_start=9;gff_end=62;gff_phase=.;gff_name=NA
AGCGACGGACGAGTAGCAGCTAAAGCTAAG
>qry2;qry_start=0;qry_stop=30;qry_len=30;gff_id=ref1;gff_type=CDS;gff_start=19;gff_end=62;gff_phase=0;gff_name=ref1-cds
AGCGACGGACGAGTAGCAGCTAAAGCTAAG
>qry4;qry_start=0;qry_stop=39;qry_len=39;gff_id=ref2;gff_type=gene;gff_start=0;gff_end=67;gff_phase=.;gff_name=NA
GAGCTGATGCACGACACGACGATCGATCGACTGTATGTA
>qry4;qry_start=0;qry_stop=34;qry_len=34;gff_id=ref2;gff_type=exon;gff_start=9;gff_end=62;gff_phase=.;gff_name=NA
GAGCTGATGCACGACACGACGATCGATCGACTGT
>qry4;qry_start=0;qry_stop=34;qry_len=34;gff_id=ref2;gff_type=CDS;gff_start=19;gff_end=62;gff_phase=0;gff_name=ref2-cds
GAGCTGATGCACGACACGACGATCGATCGACTGT