NGS-Analysis-in-R/Bioconducot

Sequence Analysis Tutorial in R and Bioconductor.

Introduction

Here I tried to learn how to Analyse NGS in R without using Linux Terminal.

Why NGS Analysis with R/Bioconductor?

• Hundreds of reusable NGS packages are available
• Invent new things rather than reinventing existing ones
• Many NGS methods require advanced statistical methods
• Many NGS applications share similar analysis needs. Most of them have existing solutions.
• Access to advanced and reproducible genome graphics

R Base

Some basic string handling utilities. Wide spectrum of numeric data analysis tools.

Bioconductor

Bioconductor packages provide much more sophisticated string handling utilities for sequence analysis (Lawrence et al. 2013; Huber et al. 2015).

Bioconductor Package Requirements

To install bioconductor packages, execute the following lines in the R console. Please also make sure that you have a recent R version installed on your system. R versions 3.3.x or higher are recommended.

source("https://bioconductor.org/biocLite.R")

if (!requireNamespace("BiocManager", quietly = TRUE))

install.packages("BiocManager") BiocManager::install(c("Biostrings", "GenomicRanges", "rtracklayer", "systemPipeR", "seqLogo", "ShortRead"))

Bioconductor packages use in NGS:

• Biostrings: general sequence analysis environment
• ShortRead: pipeline for short read data
• IRanges: low-level infrastructure for range data
• GenomicRanges: high-level infrastructure for range data
• GenomicFeatures: managing transcript centric annotations
• GenomicAlignments: handling short genomic alignments
• systemPipeR: NGS workflow and report generation environment
• Rsamtools: interface to samtools, bcftools and tabix
• BSgenome: genome annotation data
• biomaRt: interface to BioMart annotations
• rtracklayer: Annotation imports, interface to online genome browsers
• HelloRanges: Bedtools semantics in Bioc’s Ranges infrastructure

Sequences in Bioconductor

XString for single sequence :

• DNAString: for DNA
• RNAString: for RNA
• AAString: for amino acid
• BString: for any string

XStringSet for many sequences:

• DNAStringSet: for DNA
• RNAStringSet: for RNA
• AAStringSet: for amino acid
• BStringSet: for any string

QualityScaleXStringSet for sequences with quality data:

• QualityScaledDNAStringSet: for DNA
• QualityScaledRNAStringSet: for RNA
• QualityScaledAAStringSet: for amino acid
• QualityScaledBStringSet: for any string

Sequence Import and Export

Download the following sequences to your current working directory and then import them into R:

https://ftp.ncbi.nlm.nih.gov/genomes/archive/old_genbank/Bacteria/Halobacterium_sp_uid217/AE004437.ffn

NGS Sequences

Sequence and Quality Data: FASTQ Format

Four lines per sequence:

ID Sequence ID Base call qualities (Phred scores) as ASCII characters

The following gives an example of 3 Illumina reads in a FASTQ file.

1. @SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
2. CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAA
3. +SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
4. BA@7>B=>:>>7@7@>>9=BAA?;>52;>:9=8.=A

Sequence and Quality Data: QualityScaleXStringSet

Phred quality scores are integers from 0-50 that are stored as ASCII characters after adding 33. The basic R functions rawToChar and charToRaw can be used to interconvert among their representations.

Range Operations

Important Data Objects for Range Operations.

• IRanges: stores range data only (IRanges library)
• GRanges: stores ranges and annotations (GenomicRanges library)
• GRangesList: list version of GRanges container (GenomicRanges library)