pairwise_distances fails for some sequence names

[tyleraland]

I run the command:
deenurp pairwise-distances -a cmalign test.fasta out.csv

If my test.fasta looks like:

M03029:20:000000000-D0BH9:1:1101:15010:1394:3
ATTGAACGCTGGCGGCAGGT
M03029:20:000000000-D0BH9:1:1101:16823:1639:3
ATTGAACGCTGGCGGCAGGC

I get the error:
Traceback (most recent call last):
File "/home/molmicro/working/tland9/2014-12-10_lumpyplots/local-env/bin/deenurp", line 9, in
load_entry_point('deenurp==0.0.4', 'console_scripts', 'deenurp')()
File "/home/molmicro/working/tland9/2014-12-10_lumpyplots/src/deenurp/deenurp/scripts/deenurp.py", line 25, in main
return action(arguments)
File "/home/molmicro/working/tland9/2014-12-10_lumpyplots/src/deenurp/deenurp/subcommands/pairwise_distances.py", line 36, in action
taxa, distmat = filter_outliers.distmat_cmalign(args.seqs, pfx, cpu=args.threads)
File "/home/molmicro/working/tland9/2014-12-10_lumpyplots/src/deenurp/deenurp/subcommands/filter_outliers.py", line 122, in distmat_cmalign
taxa, distmat = outliers.fasttree_dists(a_fasta.name)
File "/home/molmicro/working/tland9/2014-12-10_lumpyplots/src/deenurp/deenurp/outliers.py", line 50, in fasttree_dists
taxa, distmat = read_dists(stdout)
File "/home/molmicro/working/tland9/2014-12-10_lumpyplots/src/deenurp/deenurp/outliers.py", line 21, in read_dists
N = int(fobj.readline())
ValueError: invalid literal for int() with base 10: ''

From what I can tell it's FastTree that refuses to work with these sequence names. FWIW these names are produced by usearch -cluster_fast. For now I'll just rename the sequences to an integer to produce a distance matrix and then map them back to their names.