cutadapt: error: cutadapt not able to trim the desired adaptor

[faizee-ali]

I have Illumina novaseq, pair ended reads and I want to trim the non-internal adaptors from both ends. The adaptors I used for library praparation are NEB next adaptors for illumina. So I executed the following command:-

cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTX -G XAGATCGGAAGAGCACACGTCTGAACTCCAGTCA --pair-filter=both --minimum-length 1 --cores=8 -o out-read1.fastq -p out-read2.fastq in-read1.fastq.gz in-read2.fastq.gz -o out-10936-R1.fastq

Here, the paths to the reads are correct and I am getting a vlaid output of trimmed reads. But upon inpection with FASTQC, I can see adaptor contamination still present - as seen in the attacjed fastqc report.

Is there something I am missing in the command? Are the adaptor placements correct?

[faizee-ali]

this is the QC of the raw read, cutadapt has not effectively trimmed the adaptor sequences

[benjjneb]

We only support the DADA2 R package here. Since this is about cutadapt, you should look for the support forum for cutadapt. And when describing the problem it is helpful to include the kind of data you are looking at, not just Novaseq but what the sequencing strategy was and what kind of sample it was (e.g. metagenomic data from saliva samples).