Update of document and preparation for release

RPGroup-PBoC · Jun 3, 2018 · 5c3c691 · 5c3c691
1 parent 7f44df9
commit 5c3c691
Show file tree

Hide file tree

Showing 8 changed files with 9,329 additions and 1,928 deletions.
diff --git a/doc/headers/build_main.yaml b/doc/headers/build_main.yaml
@@ -1,5 +1,6 @@
 ---
 include:
+  section_1_abstract.md
   section_2_introduction.md
   section_3_results.md
   section_4_discussion.md
@@ -8,5 +9,5 @@ include:
   section_7_references.md
 header:
   default_main.yaml
-name: mscl_main.pdf
+name: Chure2018a.pdf
 ---
diff --git a/doc/headers/build_supplement.yaml b/doc/headers/build_supplement.yaml
@@ -1,10 +1,12 @@
 ---
 include:
+  appendix_header.md
   supplemental_information_A_standard_candle.md
   supplemental_information_B_shock_classification.md
   supplemental_information_C_logistic_regression.md
+  supplemental_information_E_strains.md
   section_7_references.md
 header:
   default_supplement.yaml
-name: 20180523_final_draft_SI.html
+name: Chure2018a_supplement.pdf
 ---
diff --git a/doc/make.py b/doc/make.py
@@ -11,7 +11,7 @@ def main():
         m, _ = frontmatter.parse(f.read())
 
         code = """
-        pandoc headers/{} -i {} --bibliography=./mscl_refs.bib   --filter=pandoc-eqnos --filter=pandoc-crossref -o {}
+        pandoc headers/{} -i {} --bibliography=./mscl_refs.bib  --filter=pandoc-eqnos --columns 6 --filter=pandoc-crossref -o {}
         """.format(m['header'], m['include'], m['name'])
         os.system(code)
 

diff --git a/doc/mscl.bib b/doc/mscl.bib
diff --git a/doc/mscl_refs.bib b/doc/mscl_refs.bib
diff --git a/doc/section_5_methods.md b/doc/section_5_methods.md
@@ -2,7 +2,48 @@
 
 ### Bacterial strains and growth conditions
 
-HJ will summarize here.
+The bacterial strains are described in Table S1. The parent strain for the
+mutants used in this study was MJF641 [@edwards2012], a strain which had all seven
+mechanosensitive channels deleted. The MscL-sfGFP coding region from MLG910
+[@bialecka-fornal2012] was integrated into MJF641 by P1 transduction, creating the strain
+D6LG-Tn10. Selection pressure for MscL integration was created by
+incorporating an osmotic shock into the transduction protocol, which favored
+the survival of MscL-expressing stains relative to MJF641 by ~100-fold.
+Screening for integration candidates was based on fluorescence expression of
+plated colonies. Successful integration was verified by sequencing. Attempts
+to transduce RBS-modified MscL-sfGFP coding regions became increasingly
+inefficient as the targeted expression level of MscL was reduced. This was
+due to the decreasing fluorescence levels and survival rates of the
+integration candidates. Consequently, RBS modifications were made by
+inserting DNA oligos with lambda Red-mediated homologous recombination, i.e.,
+recombineering [Sharan 2009]. The oligos had a designed mutation (Figure 2)
+flanked by ~25 base pairs that matched the targeted MscL region [Table S2]. A
+two-step recombineering process of selection followed by counter selection
+using a tetA-sacB gene fusion cassette [@li2013] was chosen because of its
+capabilities to integrate with efficiencies comparable to P1 transduction and
+not leave antibiotic resistance markers or scar sequences in the final
+strain. To prepare the strain D6LG-Tn10 for this scheme, the Tn10 transposon
+containing the tetA gene needed to be removed to avoid interference with the
+tetA-sacB cassette. Tn10 was removed from the middle of the ycjM gene with
+the primer Tn10delR (Table S2) by recombineering, creating the strain D6LG
+(SD0). Counter selection against the tetA gene was promoted by using agar
+media with fusaric acid [@bochner1980; @li2013]. The tetA-sacB cassette was
+PCR amplified out of the strain XTL298 using primers MscLSPSac and MscLSPSacR
+(Table S2). The cassette was integrated in place of the spacer region in front
+of the MscL start codon of D6LG (SD0) by recombineering, creating the
+intermediate strain D6LTetSac. Positive selection for cassette integration
+was provided by agar media with tetracycline. Finally, the RBS modifying
+oligos were integrated into place by replacing the tetA-sacB cassette by
+recombineering. Counter selection against both tetA and sacB was ensured by
+using agar media with fusaric acid and sucrose [@li2013], creating the Shine-Dalgarno
+mutant strains used in this work.
+
+Strain cultures were grown in 5 mL of LB-Lennox media with antibiotic
+(apramycin) overnight at 37°C. The next day, 50 µL of overnight culture was
+inoculated into 5 mL of LB-Lenox with antibiotic and the culture was grown to
+OD<sub>600nm</sub> ~0.25. Subsequently, 500 µL of that culture was inoculated into 5 mL of
+LB-Lennox supplemented with 500mM of NaCl and the culture was regrown to OD<sub>600nm</sub>
+~0.25. A 1 mL aliquot was taken and used to load the flow cell.
 
 ### Flow cell
 

diff --git a/doc/section_6_acknowledgements.md b/doc/section_6_acknowledgements.md
@@ -2,6 +2,6 @@
 
 &nbsp; &nbsp; &nbsp; &nbsp;We thank Nathan Belliveau, Maja Bialecka-Fornal, Justin Bois, Soichi
 Hirokawa, Jaspar Landman, Manuel Razo-Mejia, Muir Morrison, and Shyam
-Saladi for useful advice and discussion. This work was supported by the
+Saladi for useful advice and discussion. We thank Don Court for strain XTL298 and Samantha Miller for strain MJF641. This work was supported by the
 National Institutes of Health DP1 OD000217 (Director’s Pioneer Award),
 R01 GM085286, GM084211-A1 , GM118043-01, and La Fondation Pierre Gilles de Gennes.
diff --git a/doc/supplemental_information_E_strains.md b/doc/supplemental_information_E_strains.md
@@ -0,0 +1,41 @@
+
+| Strain name  | Genotype | Reference |
+|--------------|-----------------------------------------------------------|-----------|
+| MJF641       | Frag1, *$\Delta$mscL::cm, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO, ycjM::Tn10*                | @edwards2012         |
+| MLG910       | MG1655, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$galK::kan, $\Delta$lacI, $\Delta$lacZY A*                                                        | @bialecka-fornal2012|
+| D6LG-Tn10    | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO, ycjM::Tn10* | This work |
+| D6LG (SD0)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| XTL298       | CC4231*, araD:: tetA-sacB-amp*                                                                                                                     | [@li2013] |
+| D6LTetSac    | Frag1, *mscL-sfGFP:: tetA-sacB, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*                      | This work |
+| D6LG (SD1)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (SD2)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (SD4)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (SD6)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (12SD2) | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (16SD0) | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+:*Escherichia coli* strains used in this work.
+
+
+
+| Primer Name | Sequence (5' $\rightarrow$ 3')|
+|:---------------|:----------------------------------------|
+| *Tn10delR*    | `taaagccaacggcatccaggcggacatactcagca||` |
+|               |`cctttcgcaaggtaacagagtaaaacatccaccat`|
+| *MscLSPSac*   | `gaaaatggcttaacatttgttagacttatggttgtcgg`|
+|               |`cttcat`**`agggag`**`TCCTAATTTTTGTTGACACTCTATC`|
+| *MscLSPSacR*  | `accacgttcccgcgcatcgcaaattcgcgaaat`|
+|               |`tctttaataatgctcatATCAAAGGGAAAACTGTCCATA`|
+| *MscL-SD1R*   | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |`gttatt`**`ctcctc`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-SD2R*   | `atcgcaaattcgcgaaattctttaataatgctcat`*`gttatt`*|
+|               |**`tcccct`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-SD4R*   | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`gttatt`* **`cctgct`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-SD6R*   | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`gttatt`* **`gctcgt`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-12SD2R* | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`atatatatatat`* **`tcccct`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-16SD0R* | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`atatatatatatatat`* **`ctccct`**`atgaagccgacaaccataagtctaacaaa`|
+:Oligonucleotide sequences used in this work. Bold and italics correspond to Shine-Dalgarno sequence modifications and `AT` hairpin insertion modifications, respectively. Double bar `||` indicates a transposon insertion site. 
+