Forcing merger

doc/_html/2018-05-04-strains.html~a7f1f48764c67f8af548b5f30711258794088eba

@@ -0,0 +1,41 @@
+{% raw %}<div id="refs" class="references">
+{% endraw %}{% raw %}<div id="ref-bialecka-fornal2012">
+{% endraw %}{% raw %}<p>1. Bialecka-Fornal M, Lee HJ, DeBerg HA, Gandhi CS, Phillips R. 2012. Single-Cell Census of Mechanosensitive Channels in Living Bacteria. PLoS ONE 7:e33077.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-sivia2006">
+{% endraw %}{% raw %}<p>2. Sivia D, Skilling J. 2006. Data Analysis: A Bayesian TutorialSecond Edition. Oxford University Press, Oxford, New York.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-bialecka-fornal2015">
+{% endraw %}{% raw %}<p>3. Bialecka-Fornal M, Lee HJ, Phillips R. 2015. The Rate of Osmotic Downshock Determines the Survival Probability of Bacterial Mechanosensitive Channel Mutants. Journal of Bacteriology 197:231–237.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-anderson2003">
+{% endraw %}{% raw %}<p>4. Anderson RP, Jin R, Grunkemeier GL. 2003. Understanding logistic regression analysis in clinical reports: An introduction. The Annals of Thoracic Surgery 75:753–757.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-mishra2016">
+{% endraw %}{% raw %}<p>5. Mishra V, Skotak M, Schuetz H, Heller A, Haorah J, Chandra N. 2016. Primary blast causes mild, moderate, severe and lethal TBI with increasing blast overpressures: Experimental rat injury model. Scientific Reports 6:26992.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-stahler2013">
+{% endraw %}{% raw %}<p>6. Stahler GJ, Mennis J, Belenko S, Welsh WN, Hiller ML, Zajac G. 2013. Predicting Recidivism For Released State Prison Offenders. Criminal justice and behavior 40:690–711.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-cheng2009">
+{% endraw %}{% raw %}<p>7. Cheng W, Hüllermeier E. 2009. Combining instance-based learning and logistic regression for multilabel classification. Machine Learning 76:211–225.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-dreiseitl2002">
+{% endraw %}{% raw %}<p>8. Dreiseitl S, Ohno-Machado L. 2002. Logistic regression and artificial neural network classification models: A methodology review. Journal of Biomedical Informatics 35:352–359.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-ng">
+{% endraw %}{% raw %}<p>9. Ng AY, Jordan MI. On Discriminative vs. Generative Classifiers: A comparison of logistic regression and naive Bayes 8.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-downey2014">
+{% endraw %}{% raw %}<p>10. Downey A. 2014. Probably Overthinking It: Bayes’s theorem and logistic regression. Probably Overthinking It.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-edwards2012">
+{% endraw %}{% raw %}<p>11. Edwards MD, Black S, Rasmussen T, Rasmussen A, Stokes NR, Stephen TL, Miller S, Booth IR. Jul-Aug 20122012. Characterization of three novel mechanosensitive channel activities in Escherichia coli. Channels (Austin) 6:272–81.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}<div id="ref-li2013">
+{% endraw %}{% raw %}<p>12. Li X-t, Thomason LC, Sawitzke JA, Costantino N, Court DL. 2013. Positive and negative selection using the tetA-sacB cassette: Recombineering and P1 transduction in Escherichia coli. Nucleic acids research 41:e204–e204.</p>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}</div>
+{% endraw %}{% raw %}</body>
+{% endraw %}{% raw %}</html>
+{% endraw %}

doc/headers/build_main.yaml

@@ -6,8 +6,17 @@ include:
   section_4_discussion.md
   section_5_methods.md
   section_6_acknowledgements.md
+  appendix_header.md
+  supplemental_information_A_standard_candle.md
+  supplemental_information_B_shock_classification.md
+  supplemental_information_C_logistic_regression.md
+  supplemental_information_D_strains.md
   section_7_references.md
 header:
   default_main.yaml
+<<<<<<< HEAD
 name: Chure2018a.docx
+=======
+name: Chure2018a_combined.pdf
+>>>>>>> a7f1f48764c67f8af548b5f30711258794088eba
 ---

doc/headers/build_supplement.yaml

@@ -1,6 +1,7 @@
 ---
 include:
   appendix_header.md
+<<<<<<< HEAD
   supplemental_information_A_comparison.md
   supplemental_information_B_standard_candle.md
   supplemental_information_C_survival_classification.md
@@ -12,4 +13,14 @@ include:
 header:
   default_supplement.yaml
 name: Chure2018a_SI.pdf
+=======
+  supplemental_information_A_standard_candle.md
+  supplemental_information_B_shock_classification.md
+  supplemental_information_C_logistic_regression.md
+  supplemental_information_D_strains.md
+  section_7_references.md
+header:
+  default_supplement.yaml
+name: Chure2018a_supplement.pdf
+>>>>>>> a7f1f48764c67f8af548b5f30711258794088eba
 ---

doc/headers/default_main.yaml

@@ -26,6 +26,9 @@ header-includes:
   \captionsetup[table]{name={\bf \fontfamily{phv} \selectfont TABLE}}
   \captionsetup[figure]{labelsep=space}
   \captionsetup[table]{labelsep=space}
+<<<<<<< HEAD
   \linenumbers
+=======
+>>>>>>> a7f1f48764c67f8af548b5f30711258794088eba
   \linespread{1.5}  
 ---

doc/make.py

@@ -11,7 +11,11 @@ def main():
         m, _ = frontmatter.parse(f.read())
 
         code = """
+<<<<<<< HEAD
         pandoc headers/{} -i {} --bibliography=./mscl_refs.bib --filter=pandoc-eqnos --columns 6 --filter=pandoc-crossref -o {}
+=======
+        pandoc headers/{} -i {} --bibliography=./mscl_refs.bib  --filter=pandoc-eqnos --columns 6 --filter=pandoc-crossref -o {}
+>>>>>>> a7f1f48764c67f8af548b5f30711258794088eba
         """.format(m['header'], m['include'], m['name'])
         os.system(code)
 

doc/section_5_methods.md

@@ -2,6 +2,7 @@
 
 ### Bacterial strains and growth conditions
 
+<<<<<<< HEAD
 The bacterial strains are described in Table S3. The parent strain for the
 mutants used in this study was MJF641 [@edwards2012] (generously provided by
 Drs. Samantha Miller and Ian Booth), a strain which had all seven
@@ -26,11 +27,36 @@ efficiencies comparable to P1 transduction and not leave antibiotic
 resistance markers or scar sequences in the final strain. To prepare the
 strain D6LG-Tn10 for this scheme, the Tn10 transposon containing the *tetA*
 gene needed to be removed to avoid interference with the
+=======
+The bacterial strains are described in Table S1. The parent strain for the
+mutants used in this study was MJF641 [@edwards2012], a strain which had all seven
+mechanosensitive channels deleted. The MscL-sfGFP coding region from MLG910
+[@bialecka-fornal2012] was integrated into MJF641 by P1 transduction, creating the strain
+D6LG-Tn10. Selection pressure for MscL integration was created by
+incorporating an osmotic shock into the transduction protocol, which favored
+the survival of MscL-expressing stains relative to MJF641 by ~100-fold.
+Screening for integration candidates was based on fluorescence expression of
+plated colonies. Successful integration was verified by sequencing. Attempts
+to transduce RBS-modified MscL-sfGFP coding regions became increasingly
+inefficient as the targeted expression level of MscL was reduced. This was
+due to the decreasing fluorescence levels and survival rates of the
+integration candidates. Consequently, Shine-Dalgarno sequence modifications were made by
+inserting DNA oligos with lambda Red-mediated homologous recombination, i.e.,
+recombineering [@sharan2009]. The oligos had a designed mutation ([@Fig:boxplot])
+flanked by ~25 base pairs that matched the targeted MscL region (Table S2). A
+two-step recombineering process of selection followed by counter selection
+using a *tetA-sacB* gene fusion cassette [@li2013] was chosen because of its
+capabilities to integrate with efficiencies comparable to P1 transduction and
+not leave antibiotic resistance markers or scar sequences in the final
+strain. To prepare the strain D6LG-Tn10 for this scheme, the Tn10 transposon
+containing the *tetA* gene needed to be removed to avoid interference with the
+>>>>>>> a7f1f48764c67f8af548b5f30711258794088eba
 *tetA-sacB* cassette. Tn10 was removed from the middle of the *ycjM* gene with
 the primer Tn10delR (Table S2) by recombineering, creating the strain D6LG
 (SD0). Counter selection against the *tetA* gene was promoted by using agar
 media with fusaric acid [@bochner1980; @li2013]. The *tetA-sacB* cassette was
 PCR amplified out of the strain XTL298 using primers MscLSPSac and MscLSPSacR
+<<<<<<< HEAD
 (Table S2). The cassette was integrated in place of the spacer region in
 front of the MscL start codon of D6LG (SD0) by recombineering, creating the
 intermediate strain D6LTetSac. Positive selection for cassette integration
@@ -39,6 +65,16 @@ oligos were integrated into place by replacing the *tetA-sacB* cassette by
 recombineering. Counter selection against both *tetA* and *sacB* was ensured
 by using agar media with fusaric acid and sucrose [@li2013], creating the
 Shine-Dalgarno mutant strains used in this work.
+=======
+(Table S2). The cassette was integrated in place of the spacer region in front
+of the MscL start codon of D6LG (SD0) by recombineering, creating the
+intermediate strain D6LTetSac. Positive selection for cassette integration
+was provided by agar media with tetracycline. Finally, the RBS modifying
+oligos were integrated into place by replacing the *tetA-sacB* cassette by
+recombineering. Counter selection against both *tetA* and *sacB* was ensured by
+using agar media with fusaric acid and sucrose [@li2013], creating the Shine-Dalgarno
+mutant strains used in this work.
+>>>>>>> a7f1f48764c67f8af548b5f30711258794088eba
 
 Strain cultures were grown in 5 mL of LB-Lennox media with antibiotic
 (apramycin) overnight at 37°C. The next day, 50 µL of overnight culture was

doc/section_6_acknowledgements.md

@@ -1,5 +1,6 @@
 ## Acknowledgements
 
+<<<<<<< HEAD
 &nbsp; &nbsp; &nbsp; &nbsp;We thank Nathan Belliveau, Maja Bialecka-Fornal,
 Justin Bois, Soichi Hirokawa, Jaspar Landman, Manuel Razo-Mejia, Muir
 Morrison, and Shyam Saladi for useful advice and discussion. We thank Prof.
@@ -8,3 +9,10 @@ Booth at the University of Aberdeen for strain MJF641. This work was
 supported by the National Institutes of Health DP1 OD000217 (Director’s
 Pioneer Award), R01 GM085286, GM084211-A1 , GM118043-01, and La Fondation
 Pierre Gilles de Gennes.
+=======
+&nbsp; &nbsp; &nbsp; &nbsp;We thank Nathan Belliveau, Maja Bialecka-Fornal, Justin Bois, Soichi
+Hirokawa, Jaspar Landman, Manuel Razo-Mejia, Muir Morrison, and Shyam
+Saladi for useful advice and discussion. We thank Don Court for strain XTL298 and Samantha Miller for strain MJF641. This work was supported by the
+National Institutes of Health DP1 OD000217 (Director’s Pioneer Award),
+R01 GM085286, GM084211-A1 , GM118043-01, and La Fondation Pierre Gilles de Gennes.
+>>>>>>> a7f1f48764c67f8af548b5f30711258794088eba

doc/supplemental_information_D_strains.md

@@ -0,0 +1,41 @@
+
+| Strain name  | Genotype | Reference |
+|--------------|-----------------------------------------------------------|-----------|
+| MJF641       | Frag1, *$\Delta$mscL::cm, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO, ycjM::Tn10*                | @edwards2012         |
+| MLG910       | MG1655, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$galK::kan, $\Delta$lacI, $\Delta$lacZY A*                                                        | @bialecka-fornal2012|
+| D6LG-Tn10    | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO, ycjM::Tn10* | This work |
+| D6LG (SD0)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| XTL298       | CC4231*, araD:: tetA-sacB-amp*                                                                                                                     | [@li2013] |
+| D6LTetSac    | Frag1, *mscL-sfGFP:: tetA-sacB, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*                      | This work |
+| D6LG (SD1)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (SD2)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (SD4)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (SD6)   | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (12SD2) | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+| D6LG (16SD0) | Frag1, *$\Delta$mscL ::$\phi$mscL-sfGFP, $\Delta$mscS, $\Delta$mscK::kan, $\Delta$ybdG::apr, $\Delta$ynaI, $\Delta$yjeP, $\Delta$ybiO*             | This work |
+:*Escherichia coli* strains used in this work.
+
+
+
+| Primer Name | Sequence (5' $\rightarrow$ 3')|
+|:---------------|:----------------------------------------|
+| *Tn10delR*    | `taaagccaacggcatccaggcggacatactcagca||` |
+|               |`cctttcgcaaggtaacagagtaaaacatccaccat`|
+| *MscLSPSac*   | `gaaaatggcttaacatttgttagacttatggttgtcgg`|
+|               |`cttcat`**`agggag`**`TCCTAATTTTTGTTGACACTCTATC`|
+| *MscLSPSacR*  | `accacgttcccgcgcatcgcaaattcgcgaaat`|
+|               |`tctttaataatgctcatATCAAAGGGAAAACTGTCCATA`|
+| *MscL-SD1R*   | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |`gttatt`**`ctcctc`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-SD2R*   | `atcgcaaattcgcgaaattctttaataatgctcat`*`gttatt`*|
+|               |**`tcccct`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-SD4R*   | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`gttatt`* **`cctgct`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-SD6R*   | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`gttatt`* **`gctcgt`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-12SD2R* | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`atatatatatat`* **`tcccct`**`atgaagccgacaaccataagtctaacaaa`|
+| *MscL-16SD0R* | `atcgcaaattcgcgaaattctttaataatgctcat`|
+|               |*`atatatatatatatat`* **`ctccct`**`atgaagccgacaaccataagtctaacaaa`|
+:Oligonucleotide sequences used in this work. Bold and italics correspond to Shine-Dalgarno sequence modifications and `AT` hairpin insertion modifications, respectively. Double bar `||` indicates a transposon insertion site. 
+