A small service to encode input as DNA π
Run make encode
, in the project root, to compile the executable encode
, then pass in strings as command-line arguments to see their DNA encoded version.
$ cd text2dna/
$ make encode
$ ./encode "DNA is nature's DropBox."
CACACATGCAACAGAACGGCCTATAGAACGTGCGACCTCACTCCCTAGCGCCAGCTCTATAGAACACACTAGCGTTCTAACAAGCGTTCTGAAGTG
Copyright 2016 Edmund Korley
Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.