xenoClassify

Xenoclassify 1.5: This Seqware workflow classifies short-read sequencing data generated from xenograft samples using XenoClassify.

Overview

This workflow aligns reads to Host and Graft reference genomes, classifies and filters data. There is a built-in support for single- and multi-lane alignment for RNA-seq

Dependencies

• samtools 1.14
• xenoclassify 1.0

Usage

Cromwell

java -jar cromwell.jar run xenoclassify.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter	Value	Description
inputs	Array[InputGroup]	Array of fastq files for read 1 and 2 along with rG string
reference	String	The reference of Graft to align the data with by either STAR or BWA
libraryDesign	String	Supported library design acronym. We support WG, EX, TS, WT and MR. Default is WG

Optional workflow parameters:

Parameter	Value	Default	Description
hostReference	String	"mm10"	The reference for host, most of the time it is mouse mm10
outputFileNamePrefix	String	""	Output file name prefix
filterSupAlignments	Boolean	true	Remove supplemental alignments from WT data (default true)

Optional task parameters:

Parameter	Value	Default	Description
generateHostBamWG.adapterTrimmingLog_timeout	Int	48	Hours before task timeout
generateHostBamWG.adapterTrimmingLog_jobMemory	Int	12	Memory allocated indexing job
generateHostBamWG.indexBam_timeout	Int	48	Hours before task timeout
generateHostBamWG.indexBam_modules	String	"samtools/1.9"	Modules for running indexing job
generateHostBamWG.indexBam_jobMemory	Int	12	Memory allocated indexing job
generateHostBamWG.bamMerge_timeout	Int	72	Hours before task timeout
generateHostBamWG.bamMerge_modules	String	"samtools/1.9"	Required environment modules
generateHostBamWG.bamMerge_jobMemory	Int	32	Memory allocated indexing job
generateHostBamWG.runBwamem2_timeout	Int	96	Hours before task timeout
generateHostBamWG.runBwamem2_jobMemory	Int	32	Memory allocated for this job
generateHostBamWG.runBwamem2_threads	Int	8	Requested CPU threads
generateHostBamWG.runBwamem2_addParam	String?	None	Additional BWA parameters
generateHostBamWG.adapterTrimming_timeout	Int	48	Hours before task timeout
generateHostBamWG.adapterTrimming_jobMemory	Int	16	Memory allocated for this job
generateHostBamWG.adapterTrimming_addParam	String?	None	Additional cutadapt parameters
generateHostBamWG.adapterTrimming_adapter2	String	"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"	Adapter sequence to trim from read 2
generateHostBamWG.adapterTrimming_adapter1	String	"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"	Adapter sequence to trim from read 1
generateHostBamWG.adapterTrimming_trimMinQuality	Int	0	Minimum quality of read ends to keep
generateHostBamWG.adapterTrimming_trimMinLength	Int	1	Minimum length of reads to keep
generateHostBamWG.adapterTrimming_umiLength	Int	5	The number of bases to trim when doUMItrim is true. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end
generateHostBamWG.adapterTrimming_doUMItrim	Boolean	false	If true, do umi trimming
generateHostBamWG.adapterTrimming_modules	String	"cutadapt/1.8.3"	Required environment modules
generateHostBamWG.extractUMIs_timeout	Int	12	Time in hours before task timeout
generateHostBamWG.extractUMIs_jobMemory	Int	24	Memory allocated for this job
generateHostBamWG.extractUMIs_modules	String	"barcodex-rs/0.1.2 rust/1.45.1"	Required environment modules
generateHostBamWG.extractUMIs_pattern2	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateHostBamWG.extractUMIs_pattern1	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateHostBamWG.extractUMIs_outputPrefix	String	"extractUMIs_output"	Specifies the start of the output files
generateHostBamWG.extractUMIs_umiList	String	"umiList"	Reference file with valid UMIs
generateHostBamWG.slicerR2_timeout	Int	48	Hours before task timeout
generateHostBamWG.slicerR2_jobMemory	Int	16	Memory allocated for this job
generateHostBamWG.slicerR2_modules	String	"slicer/0.3.0"	Required environment modules
generateHostBamWG.slicerR1_timeout	Int	48	Hours before task timeout
generateHostBamWG.slicerR1_jobMemory	Int	16	Memory allocated for this job
generateHostBamWG.slicerR1_modules	String	"slicer/0.3.0"	Required environment modules
generateHostBamWG.countChunkSize_timeout	Int	48	Hours before task timeout
generateHostBamWG.countChunkSize_jobMemory	Int	16	Memory allocated for this job
generateHostBamWG.countChunkSize_modules	String	"python/3.7"	Required environment modules
generateHostBamWG.numChunk	Int	1	Number of chunks to split fastq file [1, no splitting]
generateHostBamWG.doUMIextract	Boolean	false	If true, UMI will be extracted before alignment [false]
generateHostBamWG.doTrim	Boolean	false	If true, adapters will be trimmed before alignment [false]
generateHostBamWG.numReads	Int?	None	Number of reads
generateGraftBamWG.adapterTrimmingLog_timeout	Int	48	Hours before task timeout
generateGraftBamWG.adapterTrimmingLog_jobMemory	Int	12	Memory allocated indexing job
generateGraftBamWG.indexBam_timeout	Int	48	Hours before task timeout
generateGraftBamWG.indexBam_modules	String	"samtools/1.9"	Modules for running indexing job
generateGraftBamWG.indexBam_jobMemory	Int	12	Memory allocated indexing job
generateGraftBamWG.bamMerge_timeout	Int	72	Hours before task timeout
generateGraftBamWG.bamMerge_modules	String	"samtools/1.9"	Required environment modules
generateGraftBamWG.bamMerge_jobMemory	Int	32	Memory allocated indexing job
generateGraftBamWG.runBwamem2_timeout	Int	96	Hours before task timeout
generateGraftBamWG.runBwamem2_jobMemory	Int	32	Memory allocated for this job
generateGraftBamWG.runBwamem2_threads	Int	8	Requested CPU threads
generateGraftBamWG.runBwamem2_addParam	String?	None	Additional BWA parameters
generateGraftBamWG.adapterTrimming_timeout	Int	48	Hours before task timeout
generateGraftBamWG.adapterTrimming_jobMemory	Int	16	Memory allocated for this job
generateGraftBamWG.adapterTrimming_addParam	String?	None	Additional cutadapt parameters
generateGraftBamWG.adapterTrimming_adapter2	String	"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"	Adapter sequence to trim from read 2
generateGraftBamWG.adapterTrimming_adapter1	String	"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"	Adapter sequence to trim from read 1
generateGraftBamWG.adapterTrimming_trimMinQuality	Int	0	Minimum quality of read ends to keep
generateGraftBamWG.adapterTrimming_trimMinLength	Int	1	Minimum length of reads to keep
generateGraftBamWG.adapterTrimming_umiLength	Int	5	The number of bases to trim when doUMItrim is true. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end
generateGraftBamWG.adapterTrimming_doUMItrim	Boolean	false	If true, do umi trimming
generateGraftBamWG.adapterTrimming_modules	String	"cutadapt/1.8.3"	Required environment modules
generateGraftBamWG.extractUMIs_timeout	Int	12	Time in hours before task timeout
generateGraftBamWG.extractUMIs_jobMemory	Int	24	Memory allocated for this job
generateGraftBamWG.extractUMIs_modules	String	"barcodex-rs/0.1.2 rust/1.45.1"	Required environment modules
generateGraftBamWG.extractUMIs_pattern2	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateGraftBamWG.extractUMIs_pattern1	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateGraftBamWG.extractUMIs_outputPrefix	String	"extractUMIs_output"	Specifies the start of the output files
generateGraftBamWG.extractUMIs_umiList	String	"umiList"	Reference file with valid UMIs
generateGraftBamWG.slicerR2_timeout	Int	48	Hours before task timeout
generateGraftBamWG.slicerR2_jobMemory	Int	16	Memory allocated for this job
generateGraftBamWG.slicerR2_modules	String	"slicer/0.3.0"	Required environment modules
generateGraftBamWG.slicerR1_timeout	Int	48	Hours before task timeout
generateGraftBamWG.slicerR1_jobMemory	Int	16	Memory allocated for this job
generateGraftBamWG.slicerR1_modules	String	"slicer/0.3.0"	Required environment modules
generateGraftBamWG.countChunkSize_timeout	Int	48	Hours before task timeout
generateGraftBamWG.countChunkSize_jobMemory	Int	16	Memory allocated for this job
generateGraftBamWG.countChunkSize_modules	String	"python/3.7"	Required environment modules
generateGraftBamWG.numChunk	Int	1	Number of chunks to split fastq file [1, no splitting]
generateGraftBamWG.doUMIextract	Boolean	false	If true, UMI will be extracted before alignment [false]
generateGraftBamWG.doTrim	Boolean	false	If true, adapters will be trimmed before alignment [false]
generateGraftBamWG.numReads	Int?	None	Number of reads
sortHostBamWG.jobMemory	Int	10	Memory allocated to sort task
sortHostBamWG.tmpDir	String?	None	Optionally supply tmpDir for writing chunk bam files for sorting
sortHostBamWG.modules	String	"samtools/1.14"	Names and versions of modules needed for sorting
sortHostBamWG.filterSupAlignments	Boolean	false	Optional flag for removing supplemental (chimeric) alignments to prevent failures with WT data
sortHostBamWG.timeout	Int	72	Timeout for this task in hours
sortGraftBamWG.jobMemory	Int	10	Memory allocated to sort task
sortGraftBamWG.tmpDir	String?	None	Optionally supply tmpDir for writing chunk bam files for sorting
sortGraftBamWG.modules	String	"samtools/1.14"	Names and versions of modules needed for sorting
sortGraftBamWG.filterSupAlignments	Boolean	false	Optional flag for removing supplemental (chimeric) alignments to prevent failures with WT data
sortGraftBamWG.timeout	Int	72	Timeout for this task in hours
classifyWG.modules	String	"samtools/1.14 xenoclassify/1.0"	Names and versions of modules needed for classification
classifyWG.jobMemory	Int	10	Memory allocated to classify task
classifyWG.neitherThreshold	Int	20	Threshold for score below which the reads are classified as 'neither'
classifyWG.tolerance	Int	5	Tolerance around the mean of alignment scores for a set of reads classified as 'both'
classifyWG.difference	Int	5	Difference between the sum of host and graft alignment scores for a set of reads classified as 'both'
classifyWG.timeout	Int	72	Timeout for this task in hours
filterHostWG.modules	String	"samtools/1.14"	Names and versions of modules needed for filtering
filterHostWG.tmpDir	String?	None	Optionally supply tmpDir for writing chunk bam files for sorting
filterHostWG.filterTags	Array[String]	["host"]	Filter reads with these tags
filterHostWG.jobMemory	Int	5	Memory allocated to filtering task
filterHostWG.timeout	Int	72	Timeout for this task in hours
mergeBams.modules	String	"samtools/1.14"	Environment modules for the task
mergeBams.jobMemory	Int	8	Memory for the task, in gigabytes
mergeBams.timeout	Int	8	Timeout for the task, in hours
mergeReportsWG.modules	String	""	Environment modules for the task
mergeReportsWG.jobMemory	Int	4	Memory for the task, in gigabytes
mergeReportsWG.timeout	Int	4	Timeout for the task, in hours
generateHostBamWT.indexBam_timeout	Int	48	hours before task timeout
generateHostBamWT.indexBam_modules	String	"picard/2.19.2"	modules for running indexing job
generateHostBamWT.indexBam_jobMemory	Int	12	Memory allocated indexing job
generateHostBamWT.runStar_timeout	Int	72	hours before task timeout
generateHostBamWT.runStar_jobMemory	Int	64	Memory allocated for this job
generateHostBamWT.runStar_threads	Int	6	Requested CPU threads
generateHostBamWT.runStar_peOvMMp	Float	0.1	maximum proportion of mismatched bases in the overlap area
generateHostBamWT.runStar_chimSegmentReadGapMax	Int	3	maximum gap in the read sequence between chimeric segments
generateHostBamWT.runStar_peOvNbasesMin	Int	10	minimum number of overlap bases to trigger mates merging and realignment
generateHostBamWT.runStar_chimNonchimScoDMin	Int	10	to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
generateHostBamWT.runStar_chimMulmapNmax	Int	50	maximum number of chimeric multi-alignments
generateHostBamWT.runStar_chimScoreSeparation	Int	1	minimum difference (separation) between the best chimeric score and the next one
generateHostBamWT.runStar_chimScoJunNonGTAG	Int	-1	penalty for a non-GTAG chimeric junction
generateHostBamWT.runStar_chimMulmapScoRan	Int	3	the score range for multi-mapping chimeras below the best chimeric score
generateHostBamWT.runStar_alignIntMax	Int	100000	maximum intron size
generateHostBamWT.runStar_alignMatGapMax	Int	100000	maximum gap between two mates
generateHostBamWT.runStar_alignSJDBOvMin	Int	10	minimum overhang for annotated spliced alignments
generateHostBamWT.runStar_chimJunOvMin	Int	10	minimum overhang for a chimeric junction
generateHostBamWT.runStar_chimSegmin	Int	10	minimum length of chimeric segment length
generateHostBamWT.runStar_multiMax	Int	-1	multiMax parameter for STAR
generateHostBamWT.runStar_saSparsed	Int	2	saSparsed parameter for STAR
generateHostBamWT.runStar_uniqMAPQ	Int	255	Score for unique mappers
generateHostBamWT.runStar_chimScoreDropMax	Int	30	max drop (difference) of chimeric score (the sum of scores of allchimeric segments) from the read length
generateHostBamWT.runStar_outFilterMultimapNmax	Int	50	max number of multiple alignments allowed for a read: if exceeded, the read is considered unmapped
generateHostBamWT.runStar_chimOutType	String	"WithinBAM SoftClip Junctions"	Indicate where chimeric reads are to be written
generateHostBamWT.runStar_addParam	String?	None	Additional STAR parameters
generateHostBamWT.runStar_genereadSuffix	String	"ReadsPerGene.out"	ReadsPerGene file suffix
generateHostBamWT.runStar_chimericjunctionSuffix	String	"Chimeric.out"	Suffix for chimeric junction file
generateHostBamWT.runStar_transcriptomeSuffix	String	"Aligned.toTranscriptome.out"	Suffix for transcriptome-aligned file
generateHostBamWT.runStar_starSuffix	String	"Aligned.sortedByCoord.out"	Suffix for sorted file
sortHostBamWT.jobMemory	Int	10	Memory allocated to sort task
sortHostBamWT.tmpDir	String?	None	Optionally supply tmpDir for writing chunk bam files for sorting
sortHostBamWT.modules	String	"samtools/1.14"	Names and versions of modules needed for sorting
sortHostBamWT.timeout	Int	72	Timeout for this task in hours
generateGraftBamWT.indexBam_timeout	Int	48	hours before task timeout
generateGraftBamWT.indexBam_modules	String	"picard/2.19.2"	modules for running indexing job
generateGraftBamWT.indexBam_jobMemory	Int	12	Memory allocated indexing job
generateGraftBamWT.runStar_timeout	Int	72	hours before task timeout
generateGraftBamWT.runStar_jobMemory	Int	64	Memory allocated for this job
generateGraftBamWT.runStar_threads	Int	6	Requested CPU threads
generateGraftBamWT.runStar_peOvMMp	Float	0.1	maximum proportion of mismatched bases in the overlap area
generateGraftBamWT.runStar_chimSegmentReadGapMax	Int	3	maximum gap in the read sequence between chimeric segments
generateGraftBamWT.runStar_peOvNbasesMin	Int	10	minimum number of overlap bases to trigger mates merging and realignment
generateGraftBamWT.runStar_chimNonchimScoDMin	Int	10	to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
generateGraftBamWT.runStar_chimMulmapNmax	Int	50	maximum number of chimeric multi-alignments
generateGraftBamWT.runStar_chimScoreSeparation	Int	1	minimum difference (separation) between the best chimeric score and the next one
generateGraftBamWT.runStar_chimScoJunNonGTAG	Int	-1	penalty for a non-GTAG chimeric junction
generateGraftBamWT.runStar_chimMulmapScoRan	Int	3	the score range for multi-mapping chimeras below the best chimeric score
generateGraftBamWT.runStar_alignIntMax	Int	100000	maximum intron size
generateGraftBamWT.runStar_alignMatGapMax	Int	100000	maximum gap between two mates
generateGraftBamWT.runStar_alignSJDBOvMin	Int	10	minimum overhang for annotated spliced alignments
generateGraftBamWT.runStar_chimJunOvMin	Int	10	minimum overhang for a chimeric junction
generateGraftBamWT.runStar_chimSegmin	Int	10	minimum length of chimeric segment length
generateGraftBamWT.runStar_multiMax	Int	-1	multiMax parameter for STAR
generateGraftBamWT.runStar_saSparsed	Int	2	saSparsed parameter for STAR
generateGraftBamWT.runStar_uniqMAPQ	Int	255	Score for unique mappers
generateGraftBamWT.runStar_chimScoreDropMax	Int	30	max drop (difference) of chimeric score (the sum of scores of allchimeric segments) from the read length
generateGraftBamWT.runStar_outFilterMultimapNmax	Int	50	max number of multiple alignments allowed for a read: if exceeded, the read is considered unmapped
generateGraftBamWT.runStar_chimOutType	String	"WithinBAM SoftClip Junctions"	Indicate where chimeric reads are to be written
generateGraftBamWT.runStar_addParam	String?	None	Additional STAR parameters
generateGraftBamWT.runStar_genereadSuffix	String	"ReadsPerGene.out"	ReadsPerGene file suffix
generateGraftBamWT.runStar_chimericjunctionSuffix	String	"Chimeric.out"	Suffix for chimeric junction file
generateGraftBamWT.runStar_transcriptomeSuffix	String	"Aligned.toTranscriptome.out"	Suffix for transcriptome-aligned file
generateGraftBamWT.runStar_starSuffix	String	"Aligned.sortedByCoord.out"	Suffix for sorted file
sortGraftBamWT.jobMemory	Int	10	Memory allocated to sort task
sortGraftBamWT.tmpDir	String?	None	Optionally supply tmpDir for writing chunk bam files for sorting
sortGraftBamWT.modules	String	"samtools/1.14"	Names and versions of modules needed for sorting
sortGraftBamWT.timeout	Int	72	Timeout for this task in hours
classifyWT.modules	String	"samtools/1.14 xenoclassify/1.0"	Names and versions of modules needed for classification
classifyWT.jobMemory	Int	10	Memory allocated to classify task
classifyWT.neitherThreshold	Int	20	Threshold for score below which the reads are classified as 'neither'
classifyWT.tolerance	Int	5	Tolerance around the mean of alignment scores for a set of reads classified as 'both'
classifyWT.difference	Int	5	Difference between the sum of host and graft alignment scores for a set of reads classified as 'both'
classifyWT.timeout	Int	72	Timeout for this task in hours
filterHostWT.modules	String	"samtools/1.14"	Names and versions of modules needed for filtering
filterHostWT.tmpDir	String?	None	Optionally supply tmpDir for writing chunk bam files for sorting
filterHostWT.filterTags	Array[String]	["host"]	Filter reads with these tags
filterHostWT.jobMemory	Int	5	Memory allocated to filtering task
filterHostWT.timeout	Int	72	Timeout for this task in hours
makeFastq.jobMemory	Int	24	Memory allocated to the task.
makeFastq.overhead	Int	6	Ovrerhead for calculating heap memory, difference between total and Java-allocated memory
makeFastq.timeout	Int	20	Timeout in hours, needed to override imposed limits.
makeFastq.picardParams	String	"VALIDATION_STRINGENCY=LENIENT"	Additional parameters for picard SamToFastq, Default is VALIDATION_STRINGENCY=LENIENT
makeFastq.modules	String	"samtools/1.14 picard/2.21.2"	Names and versions of required modules.
generateFinalBamWT.indexBam_timeout	Int	48	hours before task timeout
generateFinalBamWT.indexBam_modules	String	"picard/2.19.2"	modules for running indexing job
generateFinalBamWT.indexBam_jobMemory	Int	12	Memory allocated indexing job
generateFinalBamWT.runStar_timeout	Int	72	hours before task timeout
generateFinalBamWT.runStar_jobMemory	Int	64	Memory allocated for this job
generateFinalBamWT.runStar_threads	Int	6	Requested CPU threads
generateFinalBamWT.runStar_peOvMMp	Float	0.1	maximum proportion of mismatched bases in the overlap area
generateFinalBamWT.runStar_chimSegmentReadGapMax	Int	3	maximum gap in the read sequence between chimeric segments
generateFinalBamWT.runStar_peOvNbasesMin	Int	10	minimum number of overlap bases to trigger mates merging and realignment
generateFinalBamWT.runStar_chimNonchimScoDMin	Int	10	to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
generateFinalBamWT.runStar_chimMulmapNmax	Int	50	maximum number of chimeric multi-alignments
generateFinalBamWT.runStar_chimScoreSeparation	Int	1	minimum difference (separation) between the best chimeric score and the next one
generateFinalBamWT.runStar_chimScoJunNonGTAG	Int	-1	penalty for a non-GTAG chimeric junction
generateFinalBamWT.runStar_chimMulmapScoRan	Int	3	the score range for multi-mapping chimeras below the best chimeric score
generateFinalBamWT.runStar_alignIntMax	Int	100000	maximum intron size
generateFinalBamWT.runStar_alignMatGapMax	Int	100000	maximum gap between two mates
generateFinalBamWT.runStar_alignSJDBOvMin	Int	10	minimum overhang for annotated spliced alignments
generateFinalBamWT.runStar_chimJunOvMin	Int	10	minimum overhang for a chimeric junction
generateFinalBamWT.runStar_chimSegmin	Int	10	minimum length of chimeric segment length
generateFinalBamWT.runStar_multiMax	Int	-1	multiMax parameter for STAR
generateFinalBamWT.runStar_saSparsed	Int	2	saSparsed parameter for STAR
generateFinalBamWT.runStar_uniqMAPQ	Int	255	Score for unique mappers
generateFinalBamWT.runStar_chimScoreDropMax	Int	30	max drop (difference) of chimeric score (the sum of scores of allchimeric segments) from the read length
generateFinalBamWT.runStar_outFilterMultimapNmax	Int	50	max number of multiple alignments allowed for a read: if exceeded, the read is considered unmapped
generateFinalBamWT.runStar_chimOutType	String	"WithinBAM SoftClip Junctions"	Indicate where chimeric reads are to be written
generateFinalBamWT.runStar_addParam	String?	None	Additional STAR parameters
generateFinalBamWT.runStar_genereadSuffix	String	"ReadsPerGene.out"	ReadsPerGene file suffix
generateFinalBamWT.runStar_chimericjunctionSuffix	String	"Chimeric.out"	Suffix for chimeric junction file
generateFinalBamWT.runStar_transcriptomeSuffix	String	"Aligned.toTranscriptome.out"	Suffix for transcriptome-aligned file
generateFinalBamWT.runStar_starSuffix	String	"Aligned.sortedByCoord.out"	Suffix for sorted file
mergeReportsWT.modules	String	""	Environment modules for the task
mergeReportsWT.jobMemory	Int	4	Memory for the task, in gigabytes
mergeReportsWT.timeout	Int	4	Timeout for the task, in hours

Outputs

Output	Type	Description
filteredResults	File	bam file without host (most commonly mouse) reads
filteredResultsIndex	File	index file for file without host reads
starChimeric	File?	Chimeric Graft junctions, provisioned for WT data only
transcriptomeBam	File?	transcriptomeBam is a file produced for Graft WT data only
geneReadFile	File?	.tab file with Graft gene read outs, only for WT data
jsonReport	File	a simple stats file with counts for differently tagged reads

Commands

This section lists command(s) run by Xenoclassify workflow

• Running Xenoclassify workflow

Xenoclassify aligns data to host and graft genomes using imported bwaMem (or star) workflow and then classify reads depending on their alignment scores. In the case of STAR we support multi-lane data. WG/EX/TS data are going to be aligned as single-lane data only.

Sort bam files by read name, optionally remove supplemental (chimeric) alignments

    if [[ "~{filterSupAlignments}" == "true" ]]; then
        samtools sort -n ~{inBam} ~{'-T ' + tmpDir} | samtools view -F 2048 - -bh > ~{basename(inBam, '.bam')}_sorted.bam
    else
        samtools sort -n ~{inBam} ~{'-T ' + tmpDir} -o ~{basename(inBam, '.bam')}_sorted.bam
    fi

Classify reads with xenoclassify.py script:

 
 xenoclassify.py is run on name-sorted bams from host and graft

 python3 $XENOCLASSIFY_ROOT/bin/xenoclassify/xenoclassify.py -H HOST_BAM -G GRAFT_BAM -O . -b -p PREFIX
                                                             -n NEITHER_THRESHOLD -t TOLERANCE -d DIFFERENCE
 ...

 samtools view PREFIX_output.bam | awk \'{print \$NF}\' | sort | uniq -c"
 counts = os.popen(command).read().splitlines() 

 Following Python code looks for host/graft (+ neither, both) classification and writes a summary into .json file

 for line in counts:
   if line.find('CL:Z:') == 0:
         continue
   line = line.rstrip()
   line = re.sub('CL:Z:', '', line)
   tmp = line.split()
   jsonDict[tmp[1]] = tmp[0]

 with open(json_name, 'w') as json_file:
   json.dump(jsonDict, json_file)
 

Filter reads matching the supplied classification(s) and provision filtered .bam along with its index

 
  The following python code splits the supplied tags and then 
  removes all matching reads from the bam file  
  
  ...

  inputTags =  "~{sep=' ' filterTags}"
  tags = inputTags.split()
  
  command = "samtools view -h XENOCLASSIFY_BAM"
  for t in tags:
    command = command + " | grep -v \'CL:Z:" + t + "\'"
  
  command = command + " | samtools sort -O bam -T  TMP_DIR -o OUTPUT_PREFIX_filtered.bam -"
  os.system(command)
  
  samtools index OUTPUT_PREFIX_filtered.bam OUTPUT_PREFIX_filtered.bai

Extract reads from filtered file into fastq format with picard:

 set -euo pipefail
 unset _JAVA_OPTIONS
 java -Xmx32G -jar picard.jar SamToFastq I=FILTERED_BAM F=FILTERED_1.fastq F2=FILTERED_2.fastq ADDITIONAL_PARAMETERS
 gzip -c FILTERED_1.fastq > OUTPUT_PREFIX_part_1.fastq.gz
 gzip -c FILTERED_2.fastq > OUTPUT_PREFIX_part_2.fastq.gz

In addition, we run second pass STAR alignments with reads from the filtered bam extracted into fastq

Merging reports - this is needed only for multi-lane transcriptome data processing For multi-lane data we also add lane identificators

   import json
   import re

   r = "~{sep=' ' inputReports}"
   inputJsons = r.split()
   inputRgs = "~{sep=' ' inputRgs}"

   data = {}

   def jsonRead(fileName):
       with open(fileName, "r") as f:
           jsonText = f.readlines()
           jsonText = "".join(jsonText)
           jsonText = jsonText.strip()
       return json.loads(jsonText)

   matches = re.findall('(?<=[ID]:)([\S]*)', inputRgs)

   if len(inputJsons) > 1:
       for j in range(len(inputJsons)):
           if matches[j]:
               data[matches[j]] = jsonRead(inputJsons[j])
   else:
       data = jsonRead(inputJsons[0])

   metrics_file = "~{outputPrefix}_tagReport.json"
   with open(metrics_file, "w") as m:
       m.write(json.dumps(data, indent=2))

Merging and indexing bam files

  set -euo pipefail
  samtools merge -o ~{outputPrefix}_filtered.bam ~{sep=" " inputBams}
  samtools index ~{outputPrefix}_filtered.bam ~{outputPrefix}_filtered.bai

Examples of json report for single-lane and multi-lane data:

single-lane:

{ "both": "286794", "host": "348954", "neither": "1140", "graft": "5607744" }

multi-lane:

{ "210601_A00469_0179_BHCKFVDRXY_1_CTGTTGAC-ACCTCAGT": { "both": "13188", "host": "5184", "graft": "233018" }, "210430_A00469_0173_AH7NV2DRXY_2_CTGTTGAC-ACCTCAGT": { "both": "11904", "host": "5076", "graft": "217000" } }

Support

For support, please file an issue on the Github project or send an email to gsi@oicr.on.ca .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)