dstern/indel_probes
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
David L. Stern Janelia Farm Research Campus 29 May 1012 This program finds oligonucleotide probe sequencing suitable for detecting polymorphisms using gDNA hybridization to probes on glass slides. For each position, one probe is made to straddle the deletion and one is specific to the insertion. Simple screens are performed to exclude runs of NNs and s1ple repeat regions. DEPENDENCIES Python 2.7 BioPython USAGE (If necessary, make file executable) chmod -x indel_probes.1.5 ./indel_probes.1.5 Two items required for input: (1) a folder of files, each containing a base-for-base sequence alignment of genomic regions from two strains/species in fasta format. e.g. >10.0_10.1_e A new nucleotide sequence entered manually CGAAGCACCTGACGGATTTCTTGGCTGGTCCATGATTAGATAAATGGAAGCCTTTCT >10.0_10.1_i A new nucleotide sequence entered manually CGAAGCACCTGACTGATTTCTTGGCTGGTCCATGATTAGATAAATGGAAGCCTTTCT (2) a 'map.txt' file of four tab-delimited columns that provides information about the alignments. (Note: file_name must match file names precisely, chromosome must be 'Chr..') file_name chromosome start_position stop_position e.g. 1 ChrX 10000000 10100000 2 ChrX 10100001 10200000 3 ChrX 10200005 10300000 3 ChrX 10300002 10400000 The output will be a list of probes for the two strains/species with each probe indicated by alignmentName_chromosome_postion_<in or del> Note, only the first contiguous string in the alignment name is used, so this should include a unique strain/species identified e.g. 10.0_10.1_e_ChrX_100003401_d CCTAACTCCAACTACAACGACGATTTGATGAGTGCAGAGTACATAACAAACTAACGCCCC 10.0_10.1_i_ChrX_100003401_i TACACCTAACTCCAACTACAACGACGAGACACTTAGGAATGTTTGATGAGTGCAGAGTCC 10.0_10.1_e_ChrX_100024401_d TGGTCAGAAAACCAAGATCATCAACCCGTGTTATTCTGTCCAAAGGGCACCTACTTCGAG 10.0_10.1_i_ChrX_100024401_i CGAAATATGGTCAGAAAATTTTAGTTTTGGGTCCAGAAGAACACCAAGATCATCAACTCG etc. OPTIONS -i --input (default = "alignments") #Name of input folder name -0 --output (default = "probes.txt") -m --map.txt_file (default = "map.txt")
About
Make oligo probes for gDNA array hybridization
Resources
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published