diff --git a/.gitignore b/.gitignore
index f68c40d..90e6c4b 100644
--- a/.gitignore
+++ b/.gitignore
@@ -1,17 +1,168 @@
# Created by .ignore support plugin (hsz.mobi)
-# Example user template template
-# Example user template
+### JetBrains template
+# Covers JetBrains IDEs: IntelliJ, RubyMine, PhpStorm, AppCode, PyCharm, CLion, Android Studio and WebStorm
+# Reference: https://intellij-support.jetbrains.com/hc/en-us/articles/206544839
-## IntelliJ project files
-**/.idea
-**/.idea/workspace.xml
+# User-specific stuff
+.idea/**/workspace.xml
+.idea/**/tasks.xml
+.idea/**/usage.statistics.xml
+.idea/**/dictionaries
+.idea/**/shelf
+
+# Sensitive or high-churn files
+.idea/**/dataSources/
+.idea/**/dataSources.ids
+.idea/**/dataSources.local.xml
+.idea/**/sqlDataSources.xml
+.idea/**/dynamic.xml
+.idea/**/uiDesigner.xml
+.idea/**/dbnavigator.xml
+
+# Gradle
+.idea/**/gradle.xml
+.idea/**/libraries
+
+# Gradle and Maven with auto-import
+# When using Gradle or Maven with auto-import, you should exclude module files,
+# since they will be recreated, and may cause churn. Uncomment if using
+# auto-import.
+# .idea/modules.xml
+# .idea/*.iml
+# .idea/modules
+
+# CMake
+cmake-build-*/
+
+# Mongo Explorer plugin
+.idea/**/mongoSettings.xml
+
+# File-based project format
+*.iws
+
+# IntelliJ
+out/
+
+# mpeltonen/sbt-idea plugin
+.idea_modules/
+
+# JIRA plugin
+atlassian-ide-plugin.xml
+
+# Cursive Clojure plugin
+.idea/replstate.xml
+
+# Crashlytics plugin (for Android Studio and IntelliJ)
+com_crashlytics_export_strings.xml
+crashlytics.properties
+crashlytics-build.properties
+fabric.properties
+
+# Editor-based Rest Client
+.idea/httpRequests
+### Python template
+# Byte-compiled / optimized / DLL files
+__pycache__/
+*.py[cod]
+*$py.class
+
+# C extensions
+*.so
+
+# Distribution / packaging
+.Python
+build/
+develop-eggs/
+dist/
+downloads/
+eggs/
+.eggs/
+lib/
+lib64/
+parts/
+sdist/
+var/
+wheels/
+*.egg-info/
+.installed.cfg
+*.egg
+MANIFEST
+
+# PyInstaller
+# Usually these files are written by a python script from a template
+# before PyInstaller builds the exe, so as to inject date/other infos into it.
+*.manifest
+*.spec
+
+# Installer logs
+pip-log.txt
+pip-delete-this-directory.txt
+
+# Unit test / coverage reports
+htmlcov/
+.tox/
+.coverage
+.coverage.*
.cache
-tests/secrets/config.json
-.DS_Store
-**/tests/secrets/config.json
-**/tests/example_outputs
-**/__pycache__/*
-**/*.pyc
-.coverage
-*.pyc
-*.xml
+nosetests.xml
+coverage.xml
+*.cover
+.hypothesis/
+.pytest_cache/
+
+# Translations
+*.mo
+*.pot
+
+# Django stuff:
+*.log
+local_settings.py
+db.sqlite3
+
+# Flask stuff:
+instance/
+.webassets-cache
+
+# Scrapy stuff:
+.scrapy
+
+# Sphinx documentation
+docs/_build/
+
+# PyBuilder
+target/
+
+# Jupyter Notebook
+.ipynb_checkpoints
+
+# pyenv
+.python-version
+
+# celery beat schedule file
+celerybeat-schedule
+
+# SageMath parsed files
+*.sage.py
+
+# Environments
+.env
+.venv
+env/
+venv/
+ENV/
+env.bak/
+venv.bak/
+
+# Spyder project settings
+.spyderproject
+.spyproject
+
+# Rope project settings
+.ropeproject
+
+# mkdocs documentation
+/site
+
+# mypy
+.mypy_cache/
+
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 51f8ba4..0000000
--- a/.travis.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-language: python
-python:
-- '3.4'
-- '3.5'
-- 3.5-dev
-- '3.6'
-- 3.6-dev
-- 3.7-dev
-- nightly
-install:
-- pip install .
-before_install:
-- openssl aes-256-cbc -K $encrypted_1b322a262dd5_key -iv $encrypted_1b322a262dd5_iv -in tests/secrets/config.json.enc -out tests/secrets/config.json -d
-- pip install lxml
-- pip install pyandoc
-- pip install pytest pytest-cov
-- pip install coveralls
-after_install:
-- pandoc --from=markdown --to=rst --output=README README.md
-script:
-- py.test --cov benchlingapi --cov-report term-missing
-after_success:
-- coveralls
-deploy:
- provider: pypi
- user: jvrana
- password:
- secure: llmNRX9uxVhHfbXf5o/ZRZAVwaA103s/5pRQqDyMOZ2okWJ/6JUpxUcPlzDq75NXIsItxby4dvErLGHt0e7yCm2nNhsztFE2klDQBsle/+O5jcC4Qn6GQ5/k/bB8dgmyKU042ius3DsqYMAbYJjGJypS61n40R+chveJ69e0SL0pTMXWs+w/bojUM0o+MT9qWuoDMPcr/Pg4zS0Nq2TFhn01WHAv9hCFurA7ptlXtUp27rrItDNFeaHqfTlnTaImrXPRPy2Jlwhh1uMYOexAHQdlYRYejebdJ2DyD3Cy/NonHcQgxYxd4Zlgms1i1U/AZd4oRx1n8Q/OpFp0zy0CoL6LfZwTfFSBpAJXBQhh+Ogq6puMpDSObf8N6KqSeyIKAKZL3EJ1uf7Yeyw6Jm6fOugIQQySsietFwTbBFbYtJA8vAwfWVAxpxePgJpj977jpo+sB558ySitud5dT+Nxbk9fIT6IhJoqdj2Me9tykw2SCE0iDKBO1VBBEjiG7gl9jNQoj8dCPdIiEhAGLCx0wPtPBK8M5V6xilh5N/1oHUZhrtqrIiL649hwB9AZ56CpEXZipuwp/Ix6sJ0qSLEXrJw6d4gZ1eOOBCD1OXwMmlzfKqH2XgEAjINCr/4arV7Yz9j27DGFmN+GNGaC6B1A6Jz4+aJMp2iAdeyhsnTcoBw=
- on:
- tags: true
- branch: master
diff --git a/LICENSE.txt b/LICENSE.txt
deleted file mode 100644
index 3309667..0000000
--- a/LICENSE.txt
+++ /dev/null
@@ -1,21 +0,0 @@
-MIT License
-
-Copyright (c) 2017 Justin Dane Vrana
-
-Permission is hereby granted, free of charge, to any person obtaining a copy
-of this software and associated documentation files (the "Software"), to deal
-in the Software without restriction, including without limitation the rights
-to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-copies of the Software, and to permit persons to whom the Software is
-furnished to do so, subject to the following conditions:
-
-The above copyright notice and this permission notice shall be included in all
-copies or substantial portions of the Software.
-
-THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-SOFTWARE.
\ No newline at end of file
diff --git a/MANIFEST.in b/MANIFEST.in
deleted file mode 100644
index 43b5f31..0000000
--- a/MANIFEST.in
+++ /dev/null
@@ -1 +0,0 @@
-include README LICENSE.txt *.md
\ No newline at end of file
diff --git a/Makefile b/Makefile
new file mode 100644
index 0000000..5c46907
--- /dev/null
+++ b/Makefile
@@ -0,0 +1,16 @@
+PIP=pip3
+
+documentation:
+ @echo "Updating docs"
+
+ # copy README.md to README.rst format for Sphinx documentation
+ # we can comment this out if we do not want to include the README.md in the sphinx documentation
+ #pipenv run pandoc --from=markdown --to=rst --output=docsrc/README.rst README.md
+
+ pandoc --from=markdown --to=rst --output=README.rst README.md
+ rm -rf docs
+ cd docsrc && pipenv run make html
+ find docs -type f -exec chmod 444 {} \;
+ @echo "\033[95m\n\nBuild successful! View the docs homepage at docs/html/index.html.\n\033[0m"
+
+ touch docs/.nojekyll
\ No newline at end of file
diff --git a/Pipfile b/Pipfile
new file mode 100644
index 0000000..ac4d396
--- /dev/null
+++ b/Pipfile
@@ -0,0 +1,21 @@
+[[source]]
+url = "https://pypi.org/simple"
+verify_ssl = true
+name = "pypi"
+
+[packages]
+requests = "*"
+marshmallow = "==2.15.1"
+inflection = "*"
+urlopen = "*"
+"bs4" = "*"
+
+[dev-packages]
+pytest = "*"
+sphinx = "*"
+pytest-cov = "*"
+pylint = "*"
+pandoc = "*"
+
+[requires]
+python_version = "3.6"
diff --git a/Pipfile.lock b/Pipfile.lock
new file mode 100644
index 0000000..4ab43d1
--- /dev/null
+++ b/Pipfile.lock
@@ -0,0 +1,441 @@
+{
+ "_meta": {
+ "hash": {
+ "sha256": "67cb19df7981a858f0e450368404535728219e4087f8e4ccb42f7b8dcd550def"
+ },
+ "pipfile-spec": 6,
+ "requires": {
+ "python_version": "3.6"
+ },
+ "sources": [
+ {
+ "name": "pypi",
+ "url": "https://pypi.org/simple",
+ "verify_ssl": true
+ }
+ ]
+ },
+ "default": {
+ "beautifulsoup4": {
+ "hashes": [
+ "sha256:272081ad78c5495ba67083a0e50920163701fa6fe67fbb5eefeb21b5dd88c40b",
+ "sha256:5a3d659840960a4107047b6328d6d4cdaaee69939bf11adc07466a1856c99a80",
+ "sha256:bd43a3b26d2886acd63070c43da821b60dea603eb6d45bab0294aac6129adbfa"
+ ],
+ "version": "==4.6.1"
+ },
+ "bs4": {
+ "hashes": [
+ "sha256:36ecea1fd7cc5c0c6e4a1ff075df26d50da647b75376626cc186e2212886dd3a"
+ ],
+ "index": "pypi",
+ "version": "==0.0.1"
+ },
+ "certifi": {
+ "hashes": [
+ "sha256:13e698f54293db9f89122b0581843a782ad0934a4fe0172d2a980ba77fc61bb7",
+ "sha256:9fa520c1bacfb634fa7af20a76bcbd3d5fb390481724c597da32c719a7dca4b0"
+ ],
+ "version": "==2018.4.16"
+ },
+ "chardet": {
+ "hashes": [
+ "sha256:84ab92ed1c4d4f16916e05906b6b75a6c0fb5db821cc65e70cbd64a3e2a5eaae",
+ "sha256:fc323ffcaeaed0e0a02bf4d117757b98aed530d9ed4531e3e15460124c106691"
+ ],
+ "version": "==3.0.4"
+ },
+ "idna": {
+ "hashes": [
+ "sha256:156a6814fb5ac1fc6850fb002e0852d56c0c8d2531923a51032d1b70760e186e",
+ "sha256:684a38a6f903c1d71d6d5fac066b58d7768af4de2b832e426ec79c30daa94a16"
+ ],
+ "version": "==2.7"
+ },
+ "inflection": {
+ "hashes": [
+ "sha256:18ea7fb7a7d152853386523def08736aa8c32636b047ade55f7578c4edeb16ca"
+ ],
+ "index": "pypi",
+ "version": "==0.3.1"
+ },
+ "marshmallow": {
+ "hashes": [
+ "sha256:a3fe4bc61c4f6902b5cc95bd34cd0803e2a09ae0ea6bf09eb8f491acebe6934c",
+ "sha256:b73361eab812af97eaf8e8691333a1096787968450051d132c8b9fb90aa1db5a"
+ ],
+ "index": "pypi",
+ "version": "==2.15.1"
+ },
+ "requests": {
+ "hashes": [
+ "sha256:63b52e3c866428a224f97cab011de738c36aec0185aa91cfacd418b5d58911d1",
+ "sha256:ec22d826a36ed72a7358ff3fe56cbd4ba69dd7a6718ffd450ff0e9df7a47ce6a"
+ ],
+ "index": "pypi",
+ "version": "==2.19.1"
+ },
+ "urllib3": {
+ "hashes": [
+ "sha256:a68ac5e15e76e7e5dd2b8f94007233e01effe3e50e8daddf69acfd81cb686baf",
+ "sha256:b5725a0bd4ba422ab0e66e89e030c806576753ea3ee08554382c14e685d117b5"
+ ],
+ "version": "==1.23"
+ },
+ "urlopen": {
+ "hashes": [
+ "sha256:3849626c61deacdd1635fe1d7019800cb0e0ae56467d66c186e17c6cd7fbdf3f"
+ ],
+ "index": "pypi",
+ "version": "==1.0.0"
+ }
+ },
+ "develop": {
+ "alabaster": {
+ "hashes": [
+ "sha256:674bb3bab080f598371f4443c5008cbfeb1a5e622dd312395d2d82af2c54c456",
+ "sha256:b63b1f4dc77c074d386752ec4a8a7517600f6c0db8cd42980cae17ab7b3275d7"
+ ],
+ "version": "==0.7.11"
+ },
+ "astroid": {
+ "hashes": [
+ "sha256:a48b57ede295c3188ef5c84273bc2a8eadc46e4cbb001eae0d49fb5d1fabbb19",
+ "sha256:d066cdeec5faeb51a4be5010da612680653d844b57afd86a5c8315f2f801b4cc"
+ ],
+ "version": "==2.0.2"
+ },
+ "atomicwrites": {
+ "hashes": [
+ "sha256:240831ea22da9ab882b551b31d4225591e5e447a68c5e188db5b89ca1d487585",
+ "sha256:a24da68318b08ac9c9c45029f4a10371ab5b20e4226738e150e6e7c571630ae6"
+ ],
+ "version": "==1.1.5"
+ },
+ "attrs": {
+ "hashes": [
+ "sha256:4b90b09eeeb9b88c35bc642cbac057e45a5fd85367b985bd2809c62b7b939265",
+ "sha256:e0d0eb91441a3b53dab4d9b743eafc1ac44476296a2053b6ca3af0b139faf87b"
+ ],
+ "version": "==18.1.0"
+ },
+ "babel": {
+ "hashes": [
+ "sha256:6778d85147d5d85345c14a26aada5e478ab04e39b078b0745ee6870c2b5cf669",
+ "sha256:8cba50f48c529ca3fa18cf81fa9403be176d374ac4d60738b839122dfaaa3d23"
+ ],
+ "version": "==2.6.0"
+ },
+ "certifi": {
+ "hashes": [
+ "sha256:13e698f54293db9f89122b0581843a782ad0934a4fe0172d2a980ba77fc61bb7",
+ "sha256:9fa520c1bacfb634fa7af20a76bcbd3d5fb390481724c597da32c719a7dca4b0"
+ ],
+ "version": "==2018.4.16"
+ },
+ "chardet": {
+ "hashes": [
+ "sha256:84ab92ed1c4d4f16916e05906b6b75a6c0fb5db821cc65e70cbd64a3e2a5eaae",
+ "sha256:fc323ffcaeaed0e0a02bf4d117757b98aed530d9ed4531e3e15460124c106691"
+ ],
+ "version": "==3.0.4"
+ },
+ "coverage": {
+ "hashes": [
+ "sha256:03481e81d558d30d230bc12999e3edffe392d244349a90f4ef9b88425fac74ba",
+ "sha256:0b136648de27201056c1869a6c0d4e23f464750fd9a9ba9750b8336a244429ed",
+ "sha256:10a46017fef60e16694a30627319f38a2b9b52e90182dddb6e37dcdab0f4bf95",
+ "sha256:198626739a79b09fa0a2f06e083ffd12eb55449b5f8bfdbeed1df4910b2ca640",
+ "sha256:23d341cdd4a0371820eb2b0bd6b88f5003a7438bbedb33688cd33b8eae59affd",
+ "sha256:28b2191e7283f4f3568962e373b47ef7f0392993bb6660d079c62bd50fe9d162",
+ "sha256:2a5b73210bad5279ddb558d9a2bfedc7f4bf6ad7f3c988641d83c40293deaec1",
+ "sha256:2eb564bbf7816a9d68dd3369a510be3327f1c618d2357fa6b1216994c2e3d508",
+ "sha256:337ded681dd2ef9ca04ef5d93cfc87e52e09db2594c296b4a0a3662cb1b41249",
+ "sha256:3a2184c6d797a125dca8367878d3b9a178b6fdd05fdc2d35d758c3006a1cd694",
+ "sha256:3c79a6f7b95751cdebcd9037e4d06f8d5a9b60e4ed0cd231342aa8ad7124882a",
+ "sha256:3d72c20bd105022d29b14a7d628462ebdc61de2f303322c0212a054352f3b287",
+ "sha256:3eb42bf89a6be7deb64116dd1cc4b08171734d721e7a7e57ad64cc4ef29ed2f1",
+ "sha256:4635a184d0bbe537aa185a34193898eee409332a8ccb27eea36f262566585000",
+ "sha256:56e448f051a201c5ebbaa86a5efd0ca90d327204d8b059ab25ad0f35fbfd79f1",
+ "sha256:5a13ea7911ff5e1796b6d5e4fbbf6952381a611209b736d48e675c2756f3f74e",
+ "sha256:69bf008a06b76619d3c3f3b1983f5145c75a305a0fea513aca094cae5c40a8f5",
+ "sha256:6bc583dc18d5979dc0f6cec26a8603129de0304d5ae1f17e57a12834e7235062",
+ "sha256:701cd6093d63e6b8ad7009d8a92425428bc4d6e7ab8d75efbb665c806c1d79ba",
+ "sha256:7608a3dd5d73cb06c531b8925e0ef8d3de31fed2544a7de6c63960a1e73ea4bc",
+ "sha256:76ecd006d1d8f739430ec50cc872889af1f9c1b6b8f48e29941814b09b0fd3cc",
+ "sha256:7aa36d2b844a3e4a4b356708d79fd2c260281a7390d678a10b91ca595ddc9e99",
+ "sha256:7d3f553904b0c5c016d1dad058a7554c7ac4c91a789fca496e7d8347ad040653",
+ "sha256:7e1fe19bd6dce69d9fd159d8e4a80a8f52101380d5d3a4d374b6d3eae0e5de9c",
+ "sha256:8c3cb8c35ec4d9506979b4cf90ee9918bc2e49f84189d9bf5c36c0c1119c6558",
+ "sha256:9d6dd10d49e01571bf6e147d3b505141ffc093a06756c60b053a859cb2128b1f",
+ "sha256:be6cfcd8053d13f5f5eeb284aa8a814220c3da1b0078fa859011c7fffd86dab9",
+ "sha256:c1bb572fab8208c400adaf06a8133ac0712179a334c09224fb11393e920abcdd",
+ "sha256:de4418dadaa1c01d497e539210cb6baa015965526ff5afc078c57ca69160108d",
+ "sha256:e05cb4d9aad6233d67e0541caa7e511fa4047ed7750ec2510d466e806e0255d6",
+ "sha256:f3f501f345f24383c0000395b26b726e46758b71393267aeae0bd36f8b3ade80"
+ ],
+ "version": "==4.5.1"
+ },
+ "docutils": {
+ "hashes": [
+ "sha256:02aec4bd92ab067f6ff27a38a38a41173bf01bed8f89157768c1573f53e474a6",
+ "sha256:51e64ef2ebfb29cae1faa133b3710143496eca21c530f3f71424d77687764274",
+ "sha256:7a4bd47eaf6596e1295ecb11361139febe29b084a87bf005bf899f9a42edc3c6"
+ ],
+ "version": "==0.14"
+ },
+ "idna": {
+ "hashes": [
+ "sha256:156a6814fb5ac1fc6850fb002e0852d56c0c8d2531923a51032d1b70760e186e",
+ "sha256:684a38a6f903c1d71d6d5fac066b58d7768af4de2b832e426ec79c30daa94a16"
+ ],
+ "version": "==2.7"
+ },
+ "imagesize": {
+ "hashes": [
+ "sha256:3620cc0cadba3f7475f9940d22431fc4d407269f1be59ec9b8edcca26440cf18",
+ "sha256:5b326e4678b6925158ccc66a9fa3122b6106d7c876ee32d7de6ce59385b96315"
+ ],
+ "version": "==1.0.0"
+ },
+ "isort": {
+ "hashes": [
+ "sha256:1153601da39a25b14ddc54955dbbacbb6b2d19135386699e2ad58517953b34af",
+ "sha256:b9c40e9750f3d77e6e4d441d8b0266cf555e7cdabdcff33c4fd06366ca761ef8",
+ "sha256:ec9ef8f4a9bc6f71eec99e1806bfa2de401650d996c59330782b89a5555c1497"
+ ],
+ "version": "==4.3.4"
+ },
+ "jinja2": {
+ "hashes": [
+ "sha256:74c935a1b8bb9a3947c50a54766a969d4846290e1e788ea44c1392163723c3bd",
+ "sha256:f84be1bb0040caca4cea721fcbbbbd61f9be9464ca236387158b0feea01914a4"
+ ],
+ "version": "==2.10"
+ },
+ "lazy-object-proxy": {
+ "hashes": [
+ "sha256:0ce34342b419bd8f018e6666bfef729aec3edf62345a53b537a4dcc115746a33",
+ "sha256:1b668120716eb7ee21d8a38815e5eb3bb8211117d9a90b0f8e21722c0758cc39",
+ "sha256:209615b0fe4624d79e50220ce3310ca1a9445fd8e6d3572a896e7f9146bbf019",
+ "sha256:27bf62cb2b1a2068d443ff7097ee33393f8483b570b475db8ebf7e1cba64f088",
+ "sha256:27ea6fd1c02dcc78172a82fc37fcc0992a94e4cecf53cb6d73f11749825bd98b",
+ "sha256:2c1b21b44ac9beb0fc848d3993924147ba45c4ebc24be19825e57aabbe74a99e",
+ "sha256:2df72ab12046a3496a92476020a1a0abf78b2a7db9ff4dc2036b8dd980203ae6",
+ "sha256:320ffd3de9699d3892048baee45ebfbbf9388a7d65d832d7e580243ade426d2b",
+ "sha256:50e3b9a464d5d08cc5227413db0d1c4707b6172e4d4d915c1c70e4de0bbff1f5",
+ "sha256:5276db7ff62bb7b52f77f1f51ed58850e315154249aceb42e7f4c611f0f847ff",
+ "sha256:61a6cf00dcb1a7f0c773ed4acc509cb636af2d6337a08f362413c76b2b47a8dd",
+ "sha256:6ae6c4cb59f199d8827c5a07546b2ab7e85d262acaccaacd49b62f53f7c456f7",
+ "sha256:7661d401d60d8bf15bb5da39e4dd72f5d764c5aff5a86ef52a042506e3e970ff",
+ "sha256:7bd527f36a605c914efca5d3d014170b2cb184723e423d26b1fb2fd9108e264d",
+ "sha256:7cb54db3535c8686ea12e9535eb087d32421184eacc6939ef15ef50f83a5e7e2",
+ "sha256:7f3a2d740291f7f2c111d86a1c4851b70fb000a6c8883a59660d95ad57b9df35",
+ "sha256:81304b7d8e9c824d058087dcb89144842c8e0dea6d281c031f59f0acf66963d4",
+ "sha256:933947e8b4fbe617a51528b09851685138b49d511af0b6c0da2539115d6d4514",
+ "sha256:94223d7f060301b3a8c09c9b3bc3294b56b2188e7d8179c762a1cda72c979252",
+ "sha256:ab3ca49afcb47058393b0122428358d2fbe0408cf99f1b58b295cfeb4ed39109",
+ "sha256:bd6292f565ca46dee4e737ebcc20742e3b5be2b01556dafe169f6c65d088875f",
+ "sha256:cb924aa3e4a3fb644d0c463cad5bc2572649a6a3f68a7f8e4fbe44aaa6d77e4c",
+ "sha256:d0fc7a286feac9077ec52a927fc9fe8fe2fabab95426722be4c953c9a8bede92",
+ "sha256:ddc34786490a6e4ec0a855d401034cbd1242ef186c20d79d2166d6a4bd449577",
+ "sha256:e34b155e36fa9da7e1b7c738ed7767fc9491a62ec6af70fe9da4a057759edc2d",
+ "sha256:e5b9e8f6bda48460b7b143c3821b21b452cb3a835e6bbd5dd33aa0c8d3f5137d",
+ "sha256:e81ebf6c5ee9684be8f2c87563880f93eedd56dd2b6146d8a725b50b7e5adb0f",
+ "sha256:eb91be369f945f10d3a49f5f9be8b3d0b93a4c2be8f8a5b83b0571b8123e0a7a",
+ "sha256:f460d1ceb0e4a5dcb2a652db0904224f367c9b3c1470d5a7683c0480e582468b"
+ ],
+ "version": "==1.3.1"
+ },
+ "markupsafe": {
+ "hashes": [
+ "sha256:a6be69091dac236ea9c6bc7d012beab42010fa914c459791d627dad4910eb665"
+ ],
+ "version": "==1.0"
+ },
+ "mccabe": {
+ "hashes": [
+ "sha256:ab8a6258860da4b6677da4bd2fe5dc2c659cff31b3ee4f7f5d64e79735b80d42",
+ "sha256:dd8d182285a0fe56bace7f45b5e7d1a6ebcbf524e8f3bd87eb0f125271b8831f"
+ ],
+ "version": "==0.6.1"
+ },
+ "more-itertools": {
+ "hashes": [
+ "sha256:c187a73da93e7a8acc0001572aebc7e3c69daf7bf6881a2cea10650bd4420092",
+ "sha256:c476b5d3a34e12d40130bc2f935028b5f636df8f372dc2c1c01dc19681b2039e",
+ "sha256:fcbfeaea0be121980e15bc97b3817b5202ca73d0eae185b4550cbfce2a3ebb3d"
+ ],
+ "version": "==4.3.0"
+ },
+ "packaging": {
+ "hashes": [
+ "sha256:e9215d2d2535d3ae866c3d6efc77d5b24a0192cce0ff20e42896cc0664f889c0",
+ "sha256:f019b770dd64e585a99714f1fd5e01c7a8f11b45635aa953fd41c689a657375b"
+ ],
+ "version": "==17.1"
+ },
+ "pandoc": {
+ "hashes": [
+ "sha256:1b54f65f127583be75c74b63378ca42a8adc80955de3d33e8915fec35617b1fd"
+ ],
+ "index": "pypi",
+ "version": "==1.0.2"
+ },
+ "pluggy": {
+ "hashes": [
+ "sha256:6e3836e39f4d36ae72840833db137f7b7d35105079aee6ec4a62d9f80d594dd1",
+ "sha256:95eb8364a4708392bae89035f45341871286a333f749c3141c20573d2b3876e1"
+ ],
+ "markers": "python_version >= '2.7' and python_version != '3.3.*' and python_version != '3.0.*' and python_version != '3.2.*' and python_version != '3.1.*'",
+ "version": "==0.7.1"
+ },
+ "ply": {
+ "hashes": [
+ "sha256:00c7c1aaa88358b9c765b6d3000c6eec0ba42abca5351b095321aef446081da3",
+ "sha256:096f9b8350b65ebd2fd1346b12452efe5b9607f7482813ffca50c22722a807ce"
+ ],
+ "version": "==3.11"
+ },
+ "py": {
+ "hashes": [
+ "sha256:3fd59af7435864e1a243790d322d763925431213b6b8529c6ca71081ace3bbf7",
+ "sha256:e31fb2767eb657cbde86c454f02e99cb846d3cd9d61b318525140214fdc0e98e"
+ ],
+ "markers": "python_version != '3.1.*' and python_version >= '2.7' and python_version != '3.0.*' and python_version != '3.2.*' and python_version != '3.3.*'",
+ "version": "==1.5.4"
+ },
+ "pygments": {
+ "hashes": [
+ "sha256:78f3f434bcc5d6ee09020f92ba487f95ba50f1e3ef83ae96b9d5ffa1bab25c5d",
+ "sha256:dbae1046def0efb574852fab9e90209b23f556367b5a320c0bcb871c77c3e8cc"
+ ],
+ "version": "==2.2.0"
+ },
+ "pylint": {
+ "hashes": [
+ "sha256:0edfec21270725c5aa8e8d8d06ef5666f766e0e748ed2f1ab23624727303b935",
+ "sha256:4cadcaa4f1fb19123d4baa758d9fbe6286c5b3aa513af6ea42a2d51d405db205"
+ ],
+ "index": "pypi",
+ "version": "==2.1.0"
+ },
+ "pyparsing": {
+ "hashes": [
+ "sha256:0832bcf47acd283788593e7a0f542407bd9550a55a8a8435214a1960e04bcb04",
+ "sha256:fee43f17a9c4087e7ed1605bd6df994c6173c1e977d7ade7b651292fab2bd010"
+ ],
+ "version": "==2.2.0"
+ },
+ "pytest": {
+ "hashes": [
+ "sha256:8214ab8446104a1d0c17fbd218ec6aac743236c6ffbe23abc038e40213c60b88",
+ "sha256:e2b2c6e1560b8f9dc8dd600b0923183fbd68ba3d9bdecde04467be6dd296a384"
+ ],
+ "index": "pypi",
+ "version": "==3.7.0"
+ },
+ "pytest-cov": {
+ "hashes": [
+ "sha256:03aa752cf11db41d281ea1d807d954c4eda35cfa1b21d6971966cc041bbf6e2d",
+ "sha256:890fe5565400902b0c78b5357004aab1c814115894f4f21370e2433256a3eeec"
+ ],
+ "index": "pypi",
+ "version": "==2.5.1"
+ },
+ "pytz": {
+ "hashes": [
+ "sha256:a061aa0a9e06881eb8b3b2b43f05b9439d6583c206d0a6c340ff72a7b6669053",
+ "sha256:ffb9ef1de172603304d9d2819af6f5ece76f2e85ec10692a524dd876e72bf277"
+ ],
+ "version": "==2018.5"
+ },
+ "requests": {
+ "hashes": [
+ "sha256:63b52e3c866428a224f97cab011de738c36aec0185aa91cfacd418b5d58911d1",
+ "sha256:ec22d826a36ed72a7358ff3fe56cbd4ba69dd7a6718ffd450ff0e9df7a47ce6a"
+ ],
+ "index": "pypi",
+ "version": "==2.19.1"
+ },
+ "six": {
+ "hashes": [
+ "sha256:70e8a77beed4562e7f14fe23a786b54f6296e34344c23bc42f07b15018ff98e9",
+ "sha256:832dc0e10feb1aa2c68dcc57dbb658f1c7e65b9b61af69048abc87a2db00a0eb"
+ ],
+ "version": "==1.11.0"
+ },
+ "snowballstemmer": {
+ "hashes": [
+ "sha256:919f26a68b2c17a7634da993d91339e288964f93c274f1343e3bbbe2096e1128",
+ "sha256:9f3bcd3c401c3e862ec0ebe6d2c069ebc012ce142cce209c098ccb5b09136e89"
+ ],
+ "version": "==1.2.1"
+ },
+ "sphinx": {
+ "hashes": [
+ "sha256:217ad9ece2156ed9f8af12b5d2c82a499ddf2c70a33c5f81864a08d8c67b9efc",
+ "sha256:a765c6db1e5b62aae857697cd4402a5c1a315a7b0854bbcd0fc8cdc524da5896"
+ ],
+ "index": "pypi",
+ "version": "==1.7.6"
+ },
+ "sphinxcontrib-websupport": {
+ "hashes": [
+ "sha256:68ca7ff70785cbe1e7bccc71a48b5b6d965d79ca50629606c7861a21b206d9dd",
+ "sha256:9de47f375baf1ea07cdb3436ff39d7a9c76042c10a769c52353ec46e4e8fc3b9"
+ ],
+ "markers": "python_version != '3.2.*' and python_version != '3.0.*' and python_version >= '2.7' and python_version != '3.3.*' and python_version != '3.1.*'",
+ "version": "==1.1.0"
+ },
+ "typed-ast": {
+ "hashes": [
+ "sha256:0948004fa228ae071054f5208840a1e88747a357ec1101c17217bfe99b299d58",
+ "sha256:10703d3cec8dcd9eef5a630a04056bbc898abc19bac5691612acba7d1325b66d",
+ "sha256:1f6c4bd0bdc0f14246fd41262df7dfc018d65bb05f6e16390b7ea26ca454a291",
+ "sha256:25d8feefe27eb0303b73545416b13d108c6067b846b543738a25ff304824ed9a",
+ "sha256:29464a177d56e4e055b5f7b629935af7f49c196be47528cc94e0a7bf83fbc2b9",
+ "sha256:2e214b72168ea0275efd6c884b114ab42e316de3ffa125b267e732ed2abda892",
+ "sha256:3e0d5e48e3a23e9a4d1a9f698e32a542a4a288c871d33ed8df1b092a40f3a0f9",
+ "sha256:519425deca5c2b2bdac49f77b2c5625781abbaf9a809d727d3a5596b30bb4ded",
+ "sha256:57fe287f0cdd9ceaf69e7b71a2e94a24b5d268b35df251a88fef5cc241bf73aa",
+ "sha256:668d0cec391d9aed1c6a388b0d5b97cd22e6073eaa5fbaa6d2946603b4871efe",
+ "sha256:68ba70684990f59497680ff90d18e756a47bf4863c604098f10de9716b2c0bdd",
+ "sha256:6de012d2b166fe7a4cdf505eee3aaa12192f7ba365beeefaca4ec10e31241a85",
+ "sha256:79b91ebe5a28d349b6d0d323023350133e927b4de5b651a8aa2db69c761420c6",
+ "sha256:8550177fa5d4c1f09b5e5f524411c44633c80ec69b24e0e98906dd761941ca46",
+ "sha256:898f818399cafcdb93cbbe15fc83a33d05f18e29fb498ddc09b0214cdfc7cd51",
+ "sha256:94b091dc0f19291adcb279a108f5d38de2430411068b219f41b343c03b28fb1f",
+ "sha256:a26863198902cda15ab4503991e8cf1ca874219e0118cbf07c126bce7c4db129",
+ "sha256:a8034021801bc0440f2e027c354b4eafd95891b573e12ff0418dec385c76785c",
+ "sha256:bc978ac17468fe868ee589c795d06777f75496b1ed576d308002c8a5756fb9ea",
+ "sha256:c05b41bc1deade9f90ddc5d988fe506208019ebba9f2578c622516fd201f5863",
+ "sha256:c9b060bd1e5a26ab6e8267fd46fc9e02b54eb15fffb16d112d4c7b1c12987559",
+ "sha256:edb04bdd45bfd76c8292c4d9654568efaedf76fe78eb246dde69bdb13b2dad87",
+ "sha256:f19f2a4f547505fe9072e15f6f4ae714af51b5a681a97f187971f50c283193b6"
+ ],
+ "version": "==1.1.0"
+ },
+ "typing": {
+ "hashes": [
+ "sha256:3a887b021a77b292e151afb75323dea88a7bc1b3dfa92176cff8e44c8b68bddf",
+ "sha256:b2c689d54e1144bbcfd191b0832980a21c2dbcf7b5ff7a66248a60c90e951eb8",
+ "sha256:d400a9344254803a2368533e4533a4200d21eb7b6b729c173bc38201a74db3f2"
+ ],
+ "version": "==3.6.4"
+ },
+ "urllib3": {
+ "hashes": [
+ "sha256:a68ac5e15e76e7e5dd2b8f94007233e01effe3e50e8daddf69acfd81cb686baf",
+ "sha256:b5725a0bd4ba422ab0e66e89e030c806576753ea3ee08554382c14e685d117b5"
+ ],
+ "version": "==1.23"
+ },
+ "wrapt": {
+ "hashes": [
+ "sha256:d4d560d479f2c21e1b5443bbd15fe7ec4b37fe7e53d335d3b9b0a7b1226fe3c6"
+ ],
+ "version": "==1.10.11"
+ }
+ }
+}
diff --git a/README b/README
deleted file mode 100644
index 5205899..0000000
--- a/README
+++ /dev/null
@@ -1,212 +0,0 @@
-Description
-===========
-
-Benchling provides a convenient way to store DNA sequences (plasmids,
-primers, pcr fragments, etc.) for an entire lab. This repo provides a
-convinient wrapper for making Benchling API requests.
-
-Features:
-
-.. raw:: html
-
-
-
-.. raw:: html
-
- -
-
-Accessing Benchling sequences and folders
-
-.. raw:: html
-
-
-
-.. raw:: html
-
- -
-
-Creating new sequences and folders
-
-.. raw:: html
-
-
-
-.. raw:: html
-
- -
-
-Searching through sequences and folders using regular expressions
-
-.. raw:: html
-
-
-
-.. raw:: html
-
- -
-
-Converting Benchling sequence JSON to genbank or FASTA files
-
-.. raw:: html
-
-
-
-.. raw:: html
-
- -
-
-Opening and accessing sequences in a Benchling Share links
-
-.. raw:: html
-
-
-
-.. raw:: html
-
-
-
-Installation
-============
-
-::
-
- cd directory/that/contains/benchling-api
- pip install .
-
-Usage
-=====
-
-Initializing the API object
----------------------------
-
-The BenchlingAPI object provides an interface for accessing Benchling
-sequences. It requires a benchling API-key, which can be requested from
-Benchling. More information on the Benchling API can be accessed here:
-https://api.benchling.com/docs/.
-
-::
-
- from benchlingapi import BenchlingAPI
-
- bench_api_key = 'sk_g7fo2vxskNUYffNPkShOFIsOmtY9ejIXX'
- benchlingapi = BenchlingAPI(bench_api_key)
-
-The first argument is the Benchling API key, which can be requested
-through benchling and accessed by scrolling to the bottom of you account
-information on Benchling.
-
-Find
-^^^^
-
-getting folders
-
-.. code:: json
-
- {'count': 59, 'created_at': '2013-10-01T20:07:18+00:00', 'description': '', 'id': 'lib_pP6d50rJn1', 'modified_at': '2017-01-20T21:57:55.991758+00:00', 'name': 'Plasmids', 'owner': 'ent_A7BlnCcJTU', 'permissions': {'admin': True, 'appendable': True, 'owner': False, 'readable': True, 'writable': True}, 'sequences': [{'id': 'seq_wHiaXdFM', 'name': 'pGPT4-pGAL1-G(m)AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_WQ0wqb9f', 'name': 'pMODU6-pGALZ4-iaaH', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_okitCPyx', 'name': 'pGPT4-pGAL1-GAVNY(VP64)', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_bw3XWuZU', 'name': 'pMODT4-pGALZ4-AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_K5hwGNwg', 'name': 'pMODU6-pGAL1-BleoMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_AyQ7ToIn', 'name': 'pBR322 (Sample Sequence)', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_t77GYXRB', 'name': 'pGPT4-pGAL1-EGFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5bmPzcKN', 'name': 'pMODU6-pGALZ4-NatMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Na2oNxzs', 'name': 'pMODU6-pGALZ4-FAR1-mut-87aa', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_0FmHFzJe', 'name': 'pMODT4-pGAL1-attB1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_m42PVReQ', 'name': 'pMODT4-pGALZ4-Z4AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_mfMW58Dd', 'name': 'pGPL5G-pGALZ4-URA3', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QteKmJdS', 'name': 'pGPT4-pGAL1-GAVNY_mutated_library', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_usn0K27s', 'name': 'pMODU6-pGALZ4-BleoMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_i0Yl6uzk', 'name': 'pMODH8-pGPD-TIR1_DM', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_TWAJLtvz', 'name': 'pMODU6-pGAL1-P1G1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2rKmILGU', 'name': 'pMODU6-pGAL1-NatMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5AXMlSvB', 'name': 'pYMOD2Kmx_pGAL1-HYG_pGAL1-iaah', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_qihkmlW4', 'name': 'pMODU6-pGAL1-AlphaFactor', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_k0MuYdIM', 'name': 'pMODU6-pGAL1-IAA17T2-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_7yXay7Ep', 'name': 'pGP8G-TIR1-Y', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_GuqSGBXY', 'name': 'pGPT4-pGAL1-GAVNY(VP64) new design', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_fkFjzKkb', 'name': 'v63_pGP8zGAL-STE5(-)RING-SNC2 C-term', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_PKJNfuZA', 'name': 'pGPH8-pGAL1-GAVNY_v2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_f4GgnFdY', 'name': 'pGPT4-pGAL1-GAVNY_seq_verified', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_SGfG2YeB', 'name': 'pMODU6-pGALZ4-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_vA5dxrqd', 'name': 'pMODU6-pGALZ4-AlphaFactor', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_tMz0Xv3g', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2xGw2yCj', 'name': 'pGPH8-pGAL1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_rwDoRd9Q', 'name': 'pMODU6-pGALZ4-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_ri07UntS', 'name': 'pMODU6-pGPD-EYFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_TsTM0B8q', 'name': 'pMOD4-pGAL1Z3(P3)-MF(AL', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QGfqobtP', 'name': 'pGPT4-pGAL1-AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_9ph0SnJV', 'name': 'AmpR-T4-pGAL1-GAL4DBD-L1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_F4tEc0XU', 'name': 'pMODU6-pGALZ4-STE5(-)RING', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_iGdjEEx4', 'name': 'pGPT4-pGAL1-P1G1-GEV', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_hhI5TTbO', 'name': 'pMODU6-pGAL1-FAR1-IAA17T2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_AgQ1w9ak', 'name': 'pLAB2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_y9xdtVx7', 'name': 'pMODKan-HO-pACT1GEV', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_D1iAdKMz', 'name': 'pGPL5G-pGAL1-URA3', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_etTsAfD4', 'name': 'pGPU6-pGALZ4-eYFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5HcRWKi8', 'name': 'pMODU6-pGALZ4-P1G1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Qc6f2Kii', 'name': 'pMOD4G-NLS_dCas9_VP64', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_VazadBJw', 'name': 'pGPT4-pGAL1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_ztl4dnOW', 'name': 'pLAB1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_kKtPZ1Rs', 'name': 'pMODT4-pGAL1-P1G1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_4ccBmI1j', 'name': 'pGPU6-pGAL1-AFB2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_tFGIIL0C', 'name': 'pMODU6-pGAL1-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_7O7ThYSI', 'name': 'pMODU6-pGALZ4-Z4AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_w2IZPFzd', 'name': 'pMODOK-pACT1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_UbsucV1t', 'name': 'pMODU6-pGAL1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Nv6wYspV', 'name': 'FAR1-mut-87aa-TP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_rzQGBzv2', 'name': 'pGP5G-ccdB', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QuWMpfRK', 'name': 'pMODT4-pGAL1-attB1-GVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_l5VHTc8Z', 'name': 'pGPU6-pGAL1-TIR1_DM', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_6VN5FDpP', 'name': 'pMODOK-pACT1-GAVN', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2MFFshfl', 'name': 'pYMOD2Kmx_pGAL1-HYG_ZEV4-cassette', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_IyZI9bEh', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T1_opt', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_beOWphBv', 'name': 'pMODKan-HO-pACT1-ZEV4', 'folder': 'lib_pP6d50rJn1'}], 'type': 'ALL'}
-
-e.g. find all sequences that contain the word "CRY2" in the name
-
-::
-
- benchlingapi.findSequence('CRY2', query='name', regex=True)
-
-e.g. find all sequences that with regular expression pattern
-
-::
-
- benchlingapi.findSequence('\wcas9.+', query='name', regex=True)
-
-e.g. find all sequence with id 'seq\_aupKOZRb'
-
-::
-
- benchlingapi.findSequence('seq_aupKOZRb', query='id', regex=False)
-
-e.g. find all folders that contain the word "CRY2" in the name
-
-::
-
- benchlingapi.findFolder('CRY2', query='name', regex=True)
-
-e.g. get all folders
-
-::
-
- benchlingapi.getFolderList()
-
-e.g. get all sequences
-
-::
-
- benchlingapi.getSequenceList()
-
-e.g. get sequence from a share link
-
-::
-
- benchlingapi.getSequenceFromShareLink('share_link')
-
-Create
-^^^^^^
-
-e.g. create a folder
-
-::
-
- benchlingapi.createFolder('new_folder', description='this is a new folder', owner='ent_OMJXXX')
-
-e.g. create a sequence
-
-::
-
- benchlingapi.createSequence(
- 'sequence name', #name
- 'agggggggtctgtagctgacttatcgtatgtgcgcga', #bases
- True, #circular or not
- 'lib_0g4T1FJV', #folder_id
- description='sequence description',
- #annotations=[], #annotations are not currently supported in Benchling's api
- )
-
-
-e.g. create a folder
-
-::
-
- benchlingapi.createFolder('folder_Name', description='folder_description', 'owner'='ent_OMJXXX')
-
-Delete
-^^^^^^
-
-e.g. delete a folder
-
-::
-
- benchlingapi.deleteFolder(folder_id)
-
-e.g. delete a sequence
-
-::
-
- benchlingapi.deleteSequence(folder_id)
-
-Edit
-^^^^
-
-e.g. edit a folder
-
-::
-
- benchlingapi.patchFolder(name=None, description=None, owner=None)
-
-e.g. edit a sequence
-
-::
-
- benchlingapi.patchsequence(name=None, bases=None, circular=None,
- folder=None, description=None, color=None)
-
-BenchlingPortal
----------------
-
-Not supported for non-aquarium users
diff --git a/README.md b/README.md
index 58e7dec..e5b9dac 100644
--- a/README.md
+++ b/README.md
@@ -1,124 +1,114 @@
-[![travis build](https://img.shields.io/travis/klavinslab/benchling-api.svg)](https://travis-ci.org/klavinslab/benchling-api)
-[![PyPI version](https://badge.fury.io/py/benchlingapi.svg)](https://badge.fury.io/py/benchlingapi)
+# BenchlingPyAPI
-# BenchlingAPI
+## Getting Started
-#### Build/Coverage Status
-Branch | Build | Coverage
-:---: | :---: | :---:
-**master** | [![travis build](https://img.shields.io/travis/klavinslab/benchling-api/master.svg)](https://travis-ci.org/klavinslab/benchling-api/master) | [![Coverage Status](https://coveralls.io/repos/github/klavinslab/benchling-api/badge.svg?branch=master)](https://coveralls.io/github/klavinslab/benchling-api?branch=master)
-**development** | [![travis build](https://img.shields.io/travis/klavinslab/benchling-api/development.svg)](https://travis-ci.org/klavinslab/benchling-api/development) | [![Coverage Status](https://coveralls.io/repos/github/klavinslab/benchling-api/badge.svg?branch=development)](https://coveralls.io/github/klavinslab/benchling-api?branch=development)
+### Installation
-## Description
-Benchling provides a convenient way to store DNA sequences (plasmids, primers, pcr
-fragments, etc.) for an entire lab. This repo provides a convinient wrapper for
-making Benchling API requests.
-
-Features:
-
-- Accessing Benchling sequences and folders
-- Creating new sequences and folders
-- Searching through sequences and folders using regular expressions
-- Converting Benchling sequence JSON to genbank or FASTA files
-- Opening and accessing sequences in a Benchling Share links
-
-
-## Installation
- pip install benchlingapi
-
-# Usage
-
-## Initializing the API object
-
-The BenchlingAPI object provides an interface for accessing Benchling sequences.
-It requires a benchling API-key, which can be requested from Benchling. More information
-on the Benchling API can be accessed here: https://api.benchling.com/docs/.
-
- from benchlingapi import BenchlingAPI
-
- bench_api_key = 'sk_g7fo2vxskNUYffNPkShOFIsOmtY9ejIXX'
- benchlingapi = BenchlingAPI(bench_api_key)
-
-The first argument is the Benchling API key, which can be requested through benchling and accessed by scrolling to the bottom of you account information on Benchling.
-
-#### Find
-
-getting folders
-```json
-{'count': 59, 'created_at': '2013-10-01T20:07:18+00:00', 'description': '', 'id': 'lib_pP6d50rJn1', 'modified_at': '2017-01-20T21:57:55.991758+00:00', 'name': 'Plasmids', 'owner': 'ent_A7BlnCcJTU', 'permissions': {'admin': True, 'appendable': True, 'owner': False, 'readable': True, 'writable': True}, 'sequences': [{'id': 'seq_wHiaXdFM', 'name': 'pGPT4-pGAL1-G(m)AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_WQ0wqb9f', 'name': 'pMODU6-pGALZ4-iaaH', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_okitCPyx', 'name': 'pGPT4-pGAL1-GAVNY(VP64)', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_bw3XWuZU', 'name': 'pMODT4-pGALZ4-AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_K5hwGNwg', 'name': 'pMODU6-pGAL1-BleoMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_AyQ7ToIn', 'name': 'pBR322 (Sample Sequence)', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_t77GYXRB', 'name': 'pGPT4-pGAL1-EGFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5bmPzcKN', 'name': 'pMODU6-pGALZ4-NatMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Na2oNxzs', 'name': 'pMODU6-pGALZ4-FAR1-mut-87aa', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_0FmHFzJe', 'name': 'pMODT4-pGAL1-attB1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_m42PVReQ', 'name': 'pMODT4-pGALZ4-Z4AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_mfMW58Dd', 'name': 'pGPL5G-pGALZ4-URA3', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QteKmJdS', 'name': 'pGPT4-pGAL1-GAVNY_mutated_library', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_usn0K27s', 'name': 'pMODU6-pGALZ4-BleoMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_i0Yl6uzk', 'name': 'pMODH8-pGPD-TIR1_DM', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_TWAJLtvz', 'name': 'pMODU6-pGAL1-P1G1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2rKmILGU', 'name': 'pMODU6-pGAL1-NatMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5AXMlSvB', 'name': 'pYMOD2Kmx_pGAL1-HYG_pGAL1-iaah', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_qihkmlW4', 'name': 'pMODU6-pGAL1-AlphaFactor', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_k0MuYdIM', 'name': 'pMODU6-pGAL1-IAA17T2-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_7yXay7Ep', 'name': 'pGP8G-TIR1-Y', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_GuqSGBXY', 'name': 'pGPT4-pGAL1-GAVNY(VP64) new design', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_fkFjzKkb', 'name': 'v63_pGP8zGAL-STE5(-)RING-SNC2 C-term', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_PKJNfuZA', 'name': 'pGPH8-pGAL1-GAVNY_v2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_f4GgnFdY', 'name': 'pGPT4-pGAL1-GAVNY_seq_verified', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_SGfG2YeB', 'name': 'pMODU6-pGALZ4-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_vA5dxrqd', 'name': 'pMODU6-pGALZ4-AlphaFactor', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_tMz0Xv3g', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2xGw2yCj', 'name': 'pGPH8-pGAL1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_rwDoRd9Q', 'name': 'pMODU6-pGALZ4-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_ri07UntS', 'name': 'pMODU6-pGPD-EYFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_TsTM0B8q', 'name': 'pMOD4-pGAL1Z3(P3)-MF(AL', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QGfqobtP', 'name': 'pGPT4-pGAL1-AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_9ph0SnJV', 'name': 'AmpR-T4-pGAL1-GAL4DBD-L1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_F4tEc0XU', 'name': 'pMODU6-pGALZ4-STE5(-)RING', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_iGdjEEx4', 'name': 'pGPT4-pGAL1-P1G1-GEV', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_hhI5TTbO', 'name': 'pMODU6-pGAL1-FAR1-IAA17T2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_AgQ1w9ak', 'name': 'pLAB2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_y9xdtVx7', 'name': 'pMODKan-HO-pACT1GEV', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_D1iAdKMz', 'name': 'pGPL5G-pGAL1-URA3', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_etTsAfD4', 'name': 'pGPU6-pGALZ4-eYFP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_5HcRWKi8', 'name': 'pMODU6-pGALZ4-P1G1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Qc6f2Kii', 'name': 'pMOD4G-NLS_dCas9_VP64', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_VazadBJw', 'name': 'pGPT4-pGAL1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_ztl4dnOW', 'name': 'pLAB1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_kKtPZ1Rs', 'name': 'pMODT4-pGAL1-P1G1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_4ccBmI1j', 'name': 'pGPU6-pGAL1-AFB2', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_tFGIIL0C', 'name': 'pMODU6-pGAL1-FAR1', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_7O7ThYSI', 'name': 'pMODU6-pGALZ4-Z4AVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_w2IZPFzd', 'name': 'pMODOK-pACT1-GAVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_UbsucV1t', 'name': 'pMODU6-pGAL1-HygMX', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_Nv6wYspV', 'name': 'FAR1-mut-87aa-TP', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_rzQGBzv2', 'name': 'pGP5G-ccdB', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_QuWMpfRK', 'name': 'pMODT4-pGAL1-attB1-GVNY', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_l5VHTc8Z', 'name': 'pGPU6-pGAL1-TIR1_DM', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_6VN5FDpP', 'name': 'pMODOK-pACT1-GAVN', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_2MFFshfl', 'name': 'pYMOD2Kmx_pGAL1-HYG_ZEV4-cassette', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_IyZI9bEh', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T1_opt', 'folder': 'lib_pP6d50rJn1'}, {'id': 'seq_beOWphBv', 'name': 'pMODKan-HO-pACT1-ZEV4', 'folder': 'lib_pP6d50rJn1'}], 'type': 'ALL'}
+```
+pip3 install benchlingapi -U
```
-e.g. find all sequences that contain the word "CRY2" in the name
+### Creating new session
+You'll need a BenchlingAPI key...
+```python
+from benchlingapi import Session
- benchlingapi.findSequence('CRY2', query='name', regex=True)
-
-e.g. find all sequences that with regular expression pattern
+session = Session('api_key_128795879dfkshdf')
+```
- benchlingapi.findSequence('\wcas9.+', query='name', regex=True)
-
-e.g. find all sequence with id 'seq_aupKOZRb'
+### Available Models
- benchlingapi.findSequence('seq_aupKOZRb', query='id', regex=False)
-
-
-e.g. find all folders that contain the word "CRY2" in the name
+Models can be accessed by `session.[ModelName]` such as `session.DNASequenc`
- benchlingapi.findFolder('CRY2', query='name', regex=True)
-
-e.g. get all folders
+List of models can be printed using `print(session.models)`
- benchlingapi.getFolderList()
-
-e.g. get all sequences
-
- benchlingapi.getSequenceList()
-
-e.g. get sequence from a share link
+#### Models:
- benchlingapi.getSequenceFromShareLink('share_link')
+`DNASequence` - a DNA sequence
-#### Create
+`AASequence` - a protein
-e.g. create a folder
+`Oligo` - a primer
- benchlingapi.createFolder('new_folder', description='this is a new folder', owner='ent_OMJXXX')
+`Project`
-e.g. create a sequence
+`Folder`
- benchlingapi.createSequence(
- 'sequence name', #name
- 'agggggggtctgtagctgacttatcgtatgtgcgcga', #bases
- True, #circular or not
- 'lib_0g4T1FJV', #folder_id
- description='sequence description',
- #annotations=[], #annotations are not currently supported in Benchling's api
- )
-
-e.g. create a folder
+... more to come?
- benchlingapi.createFolder('folder_Name', description='folder_description', 'owner'='ent_OMJXXX')
-
-#### Delete
-e.g. delete a folder
+### Model Methods
- benchlingapi.deleteFolder(folder_id)
+`find` - find model by id
+```python
+seq = session.DNASequence.find('seq-324jl5')
+```
-e.g. delete a sequence
+`find_by_name` - iterates through models to find the first DNA sequence with the given name
+```python
+seq = session.DNASequence.find_by_name("puc19-GFP")
+```
- benchlingapi.deleteSequence(folder_id)
+```python
+# narrow down the search to a particular project
+project = session.Project.find_by_name("MyProject")
+seq = session.DNASequence.find_by_name("puc19-GFP", projectId=project.id)
+```
-#### Edit
+`list` - list all models
-e.g. edit a folder
+```python
+seqs = session.DNASequence.list()
+```
- benchlingapi.patchFolder(name=None, description=None, owner=None)
+`list_pages` - return paginated list of models
-e.g. edit a sequence
+```python
+for seqs in session.DNASequence.list_pages():
+ print(seq)
+```
- benchlingapi.patchsequence(name=None, bases=None, circular=None,
- folder=None, description=None, color=None)
+`update` - updates model to Benchling
-## BenchlingPortal
+```python
+folder = session.Folder.find_by_name('MyFolder')
+folder.name = "My New Name"
+folder.update()
+```
-Not supported for non-aquarium users
+`save` - saves a new model to Benchling
+
+```python
+# find folder
+folder = session.Folder.find_by_name("Primers", projectId=session.Project.find_by_name("API_Folder").id)
+
+# create some annotations
+annotation1 = {
+ "color": "#FF9CCD",
+ "end": 3,
+ "name": "bla gene",
+ "start": 1,
+ "strand": 1,
+ "type": "gene"
+}
+annotation2 = {
+ "color": "#FF9CCD",
+ "end": 5,
+ "name": "bla gene",
+ "start": 1,
+ "strand": -1,
+ "type": "gene"
+}
+
+# make a new sequence
+new_seq = session.DNASequence(
+ bases="AGCGTATGTGTGTA",
+ name="MyNewSeq",
+ isCircular=False,
+ annotations=[annotation1, annotation2],
+ folderId=folder.id
+)
+
+# save it to benchling
+new_seq.save()
+```
\ No newline at end of file
diff --git a/README.rst b/README.rst
new file mode 100644
index 0000000..a895793
--- /dev/null
+++ b/README.rst
@@ -0,0 +1,2 @@
+BenchlingPyAPI
+==============
diff --git a/benchlingapi/__init__.py b/benchlingapi/__init__.py
index 9564e5d..4a54f94 100644
--- a/benchlingapi/__init__.py
+++ b/benchlingapi/__init__.py
@@ -1,2 +1,17 @@
-__version__ = "1.0"
+"""
+.. module:: benchlingapi
+Submodules
+==========
+.. autosummary::
+ :toctree: _autosummary
+ base
+ exceptions
+ models
+ schema
+ session
+ utils
+"""
+from .__version__ import __description__, __author__, __version__, __url__, __title__
+from benchlingapi import schema # must import schema before session
+from benchlingapi.session import Session
\ No newline at end of file
diff --git a/benchlingapi/__pycache__/__init__.cpython-35.pyc b/benchlingapi/__pycache__/__init__.cpython-35.pyc
deleted file mode 100644
index 5e173fe..0000000
Binary files a/benchlingapi/__pycache__/__init__.cpython-35.pyc and /dev/null differ
diff --git a/benchlingapi/__pycache__/__init__.cpython-36.pyc b/benchlingapi/__pycache__/__init__.cpython-36.pyc
deleted file mode 100644
index f3a8f5e..0000000
Binary files a/benchlingapi/__pycache__/__init__.cpython-36.pyc and /dev/null differ
diff --git a/benchlingapi/__pycache__/benchlingapi.cpython-36.pyc b/benchlingapi/__pycache__/benchlingapi.cpython-36.pyc
deleted file mode 100644
index 5aa35b9..0000000
Binary files a/benchlingapi/__pycache__/benchlingapi.cpython-36.pyc and /dev/null differ
diff --git a/benchlingapi/__pycache__/convert.cpython-36.pyc b/benchlingapi/__pycache__/convert.cpython-36.pyc
deleted file mode 100644
index 053f55d..0000000
Binary files a/benchlingapi/__pycache__/convert.cpython-36.pyc and /dev/null differ
diff --git a/benchlingapi/__version__.py b/benchlingapi/__version__.py
new file mode 100644
index 0000000..805c0bb
--- /dev/null
+++ b/benchlingapi/__version__.py
@@ -0,0 +1,8 @@
+# TRIDENT
+
+__title__ = 'BenchlingAPI'
+__description__ = 'Shallow wrapper for the BenchlingAPI (https://docs.benchling.com)'
+__url__ = 'http://klavinslab.org/benchlingapi'
+__version__ = '2.0.0a0'
+__author__ = 'Justin D Vrana'
+__author_email__ = "justin.vrana@gmail.com"
\ No newline at end of file
diff --git a/benchlingapi/base.py b/benchlingapi/base.py
index 380193c..405e63a 100644
--- a/benchlingapi/base.py
+++ b/benchlingapi/base.py
@@ -1,16 +1,21 @@
import inflection
+from marshmallow import class_registry
+from marshmallow import __version__
+from distutils.version import LooseVersion
from benchlingapi.exceptions import ModelNotFoundError
+from benchlingapi.utils import url_build
class ModelRegistry(type):
"""Stores a list of models that can be accessed by name."""
models = {}
- def __init__(cls, name, bases, selfdict):
+ def __init__(cls, name, bases, nmspc):
"""Saves model to the registry"""
- super().__init__(name, bases, selfdict)
+ super().__init__(name, bases, nmspc)
if not name == "ModelBase":
- ModelRegistry.models[name] = cls
+ if name not in ModelRegistry.models:
+ ModelRegistry.models[name] = cls
@staticmethod
def get_model(model_name):
@@ -27,56 +32,190 @@ def __getattr__(cls, item):
Its likely that user may have wanted to use a model interface instead of
the Base class.
"""
- raise AttributeError("'{0}' has no attribute '{1}'. Method may be a ModelInterface method."
- " Did you mean '.{0}.{1}'?"
+ raise AttributeError("'{0}' has no attribute '{1}'"
.format(cls.__name__, item))
+ @property
+ def model_name(cls):
+ # if cls.alias is not None:
+ # return cls.alias
+ return cls.__name__
-class ModelBase(object):
- class ModelBase(object, metaclass=ModelRegistry):
- def __init__(self):
- self.http = None
- self.data = None
-
- @classmethod
- def path(cls):
- name = inflection.underscore(cls.__name__)
- name = inflection.dasherize(name)
- name = inflection.pluralize(name)
- return name
-
- @classmethod
- def all(cls, http):
- return http.post(cls.path())
-
- @classmethod
- def find(cls, http, model_id):
- return http.get(f"{cls.path()}/{model_id}")
-
- @classmethod
- def delete(cls, http, model_id):
- return http.delete(f"{cls.path()}/{model_id}")
-
- @classmethod
- def create(cls, http, json_data):
- return http.post(f"{cls.path()}", json_data=json_data)
+class ModelBase(object, metaclass=ModelRegistry):
+ # http = None # initialized with Session calls a model interface
+ session = None
+ alias = None
-class ModelInterface(object):
+ def __init__(self, **data):
+ self.__dict__.update(data)
- def __init__(self, model_name, http):
- self.model_name = model_name
- self.http = http
- self.model = ModelRegistry.get_model(model_name)
+ @property
+ def model_name(self):
+ # if self.alias is not None:
+ # return self.alias
+ return self.__class__.__name__
- def all(self):
- return self.model.post(self.http)
+ @classmethod
+ def schema(cls, *args, **kwargs):
+ schema = class_registry.get_class(cls.__name__ + "Schema")
+ schema_inst = schema(*args, **kwargs)
+ schema_inst.context["session"] = cls.session
+ return schema_inst
- def find(self, model_id):
- return self.model.find(self.http, model_id)
-
- def delete(self, model_id):
- return self.model.delete(self.http, model_id)
-
- def create(self, json_data):
- return self.model.create(self.http, json_data)
\ No newline at end of file
+ # TODO: remove schema_loader for marshmallow > 3
+ @staticmethod
+ def schema_loader(schema_inst, data):
+ result = schema_inst.load(data)
+ if LooseVersion(__version__) < LooseVersion('3.0.0'):
+ if len(result.errors) > 0:
+ raise Exception(str(result.errors))
+ return result.data
+ return result
+
+ # TODO: remove schema_dumper for marshmallow > 3
+ @staticmethod
+ def schema_dumper(schema_inst, inst):
+ result = schema_inst.dump(inst)
+ if LooseVersion(__version__) < LooseVersion('3.0.0'):
+ if len(result.errors) > 0:
+ raise Exception(str(result.errors))
+ return result.data
+ return result
+
+ @classmethod
+ def load(cls, data, *args, **kwargs):
+ schema_inst = cls.schema(*args, **kwargs)
+ inst = cls.schema_loader(schema_inst, data)
+ inst.raw = data
+ return inst
+
+ @classmethod
+ def load_many(cls, data, *args, **kwargs):
+ schema_inst = cls.schema(*args, many=True, **kwargs)
+ # TODO: change for marshmallow > v3
+ insts = cls.schema_loader(schema_inst, data)
+ for inst_data, inst in zip(data, insts):
+ try:
+ inst.raw = inst_data
+ except:
+ pass
+ return insts
+
+ @classmethod
+ def tableize(cls):
+ name = inflection.tableize(cls.__name__)
+ name = inflection.dasherize(name)
+ return name
+
+ @classmethod
+ def camelize(cls, property=None):
+ name = inflection.underscore(cls.model_name)
+ if property is not None:
+ name += "_" + inflection.pluralize(property)
+ else:
+ name = inflection.pluralize(name)
+ name = inflection.camelize(name)
+ name = name[0].lower() + name[1:]
+ return name
+
+ @classmethod
+ def path(cls, additional_paths=None):
+ path = [cls.tableize()]
+ if additional_paths is not None:
+ if not isinstance(additional_paths, list):
+ additional_paths = [additional_paths]
+ path += additional_paths
+ return url_build(*path)
+
+ @classmethod
+ def _get(cls, path_params=None, params=None, action=None):
+ response = cls.session.http.get(cls.path(additional_paths=path_params), params=params, action=action)
+ return response
+ # return cls.load(response)
+
+ @classmethod
+ def _get_pages(cls, path_params=None, params=None, action=None):
+ pages = cls.session.http.get_pages(cls.path(additional_paths=path_params), params=params, action=action)
+ return pages
+
+ @classmethod
+ def _post(cls, data, path_params=None, params=None, action=None):
+ response = cls.session.http.post(cls.path(additional_paths=path_params), json=data, params=params,
+ action=action)
+ return response
+
+ @classmethod
+ def _patch(cls, data, path_params=None, params=None, action=None):
+ response = cls.session.http.patch(cls.path(additional_paths=path_params), json=data, params=params,
+ action=action)
+ return response
+
+ @classmethod
+ def list(cls, **params):
+ response = cls._get(params=params)
+ return cls.load_many(response[cls.camelize()])
+
+ @classmethod
+ def get(cls, id, **params):
+ response = cls._get(id, params=params)
+ return cls.load(response)
+
+ @classmethod
+ def find(cls, id, **params):
+ cls.get(id, **params)
+
+ @classmethod
+ def find_by_name(cls, name, **page_params):
+ for page in cls.list_pages(**page_params):
+ for inst in page:
+ if inst.name == name:
+ return inst
+
+ @classmethod
+ def list_pages(cls, **params):
+ generator = cls._get_pages(params=params)
+ response = next(generator, None)
+ while response is not None:
+ yield cls.load_many(response[cls.camelize()])
+
+ response = next(generator, None)
+
+ @classmethod
+ def update_model(cls, model_id, data, **params):
+ response = cls._patch(data, path_params=[model_id], **params)
+ return cls.load(response)
+
+ @classmethod
+ def create_model(cls, data, **params):
+ response = cls._post(data, **params)
+ return cls.load(response)
+
+ def create(self, data):
+ r = self.create_model(data)
+ self.__dict__.update(r.__dict__)
+ return self
+
+ def update(self, data):
+ r = self.update_model(self.id, data)
+ self.__dict__.update(r.__dict__)
+ return self
+
+ # return cls._get_pages()
+
+ # return cls._get(id)
+ #
+ # def bulk_get(self, ids):
+ # return self._get(params={self.camelize("id"): ids}, action="bulk-get")
+ #
+ # def create(self, data):
+ # return self._post(data)
+ #
+ # def bulk_create(self, data):
+ # return self._post(data, action="bulk-create")
+ #
+ # def update(self, id, data):
+ # return self._patch(data, path_params=id)
+
+ def __repr__(self):
+ return f"<{self.__class__.__name__} ({self.__class__.model_name}) at {id(self)}>"
diff --git a/benchlingapi/exceptions.py b/benchlingapi/exceptions.py
index f60320d..9ef0f57 100644
--- a/benchlingapi/exceptions.py
+++ b/benchlingapi/exceptions.py
@@ -6,9 +6,12 @@ class BenchlingLoginError(Exception):
"""Errors for incorrect login credentials"""
-class AquariumLoginError(Exception):
- """Errors for incorrect Aquarium login credentials"""
+# class AquariumLoginError(Exception):
+# """Errors for incorrect Aquarium login credentials"""
class ModelNotFoundError(Exception):
+ """Model not found"""
+
+class SchemaNotFoundError(Exception):
"""Model not found"""
\ No newline at end of file
diff --git a/benchlingapi/http.py b/benchlingapi/http.py
deleted file mode 100644
index 165dc23..0000000
--- a/benchlingapi/http.py
+++ /dev/null
@@ -1,118 +0,0 @@
-import requests
-from benchlingapi.exceptions import BenchlingAPIException
-import json
-import inflection
-from benchlingapi.base import ModelInterface
-
-
-def url_build(*parts):
- """Join parts of a url into a string"""
- return '/'.join(p.strip('/') for p in parts)
-
-
-class RequestDecorator(object):
- """
- Wraps a function to raise error with unexpected request status codes
- """
- def __init__(self, status_codes):
- if not isinstance(status_codes, list):
- status_codes = [status_codes]
- self.code = status_codes
-
- def __call__(self, f):
- def wrapped_f(*args, **kwargs):
- r = f(*args)
- if r.status_code not in self.code:
- http_codes = {
- 403: "FORBIDDEN",
- 404: "NOT FOUND",
- 500: "INTERNAL SERVER ERROR",
- 503: "SERVICE UNAVAILABLE",
- 504: "SERVER TIMEOUT"}
- msg = ""
- if r.status_code in http_codes:
- msg = http_codes[r.status_code]
- raise BenchlingAPIException("HTTP Response Failed {} {}".format(
- r.status_code, msg))
- return json.loads(r.text)
-
- return wrapped_f
-
-
-
-class AqHTTP(object):
-
- TIMEOUT = 10
-
- def __init__(self, apikey, home='https://api.benchling.com/v1/'):
- session = requests.Session()
- session.auth = apikey
- self._session = session
- self.home = home
-
- def request(self, method, path, timeout=None, **kwargs):
- if timeout is None:
- timeout = self.TIMEOUT
- return self._session.request(method, url_build(self.home, path), timeout=timeout, **kwargs)
-
- @RequestDecorator([200, 201, 202])
- def post(self, path, json_data=None):
- if json_data is None:
- json_data = {}
- return self.request("post", path, json_data=json_data)
-
- @RequestDecorator(200)
- def get(self, path):
- return self.request("get", path)
-
- @RequestDecorator(200)
- def delete(self, path):
- return self.request("delete", path)
-
- @RequestDecorator([200, 201])
- def patch(self, path, json_data=None):
- if json_data is None:
- json_data = {}
- return self.request("patch", path, json_data=json_data)
-
- def model_interface(self, model_name):
- return ModelInterface(model_name, self)
-
-
-
-
-class ModelBase(object, metaclass=ModelRegistry):
-
- def __init__(self):
- self.http = None
- self.data = None
-
- @classmethod
- def path(cls):
- name = inflection.underscore(cls.__name__)
- name = inflection.dasherize(name)
- name = inflection.pluralize(name)
- return name
-
- @classmethod
- def all(cls, http):
- return http.post(cls.path())
-
- @classmethod
- def find(cls, http, model_id):
- return http.get(f"{cls.path()}/{model_id}")
-
- @classmethod
- def delete(cls, http, model_id):
- return http.delete(f"{cls.path()}/{model_id}")
-
- @classmethod
- def create(cls, http, json_data):
- return http.post(f"{cls.path()}", json_data=json_data)
-
-
-
-
-
-
-
diff --git a/benchlingapi/interface.py b/benchlingapi/interface.py
deleted file mode 100644
index 1e44db2..0000000
--- a/benchlingapi/interface.py
+++ /dev/null
@@ -1,11 +0,0 @@
-from benchlingapi.base import ModelRegistry
-
-class ModelInterface(object):
-
- def __init__(self, model_name, http):
- self.model_name = model_name
- self.http = http
- self.model = ModelRegistry.get_model(model_name)
-
- def find(self, model_id):
- return self.model.find()
\ No newline at end of file
diff --git a/benchlingapi/models.py b/benchlingapi/models.py
index b54be95..8f3eed7 100644
--- a/benchlingapi/models.py
+++ b/benchlingapi/models.py
@@ -1,38 +1,159 @@
-
-
-class Sequence(object):
-
- def __init__(self, **kwargs):
- self.__dict__.update(kwargs)
-
-
-class Folder(object):
-
- def __init__(self, **kwargs):
- self.__dict__.update(kwargs)
-
-
-class Tag(object):
-
- def __init__(self, **kwargs):
- self.__dict__.update(kwargs)
-
-
-class Annotation(object):
-
- def __init__(self, **kwargs):
- self.__dict__.update(kwargs)
-
-
-class Primer(object):
-
- def __init__(self, **kwargs):
- self.__dict__.update(kwargs)
-
-
-class Entity(object):
-
- def __init__(self, **kwargs):
- self.__dict__.update(kwargs)
-
-
+from benchlingapi.base import ModelBase
+from benchlingapi.exceptions import BenchlingAPIException
+from urllib.request import urlopen
+from bs4 import BeautifulSoup
+import re
+
+__all__ = [
+ "DNASequence",
+ "AASequence",
+ "Annotation",
+ "Oligo",
+ "Translation",
+ "Folder",
+ "Project",
+]
+
+
+class ArchiveMixin(object):
+ REASONS = ["Made in error", "Retired", "Expended", "Shipped", "Contaminated", "Expired", "Missing", "Other"]
+
+ @classmethod
+ def archive_many(cls, model_ids, reason):
+ if reason not in cls.REASONS:
+ raise Exception("Reason must be one of {}".format(cls.REASONS))
+ key = cls.camelize("id")
+ return cls._post(action="archive", data={key: model_ids, "reason": reason})
+
+ @classmethod
+ def unarchive_many(cls, model_ids):
+ key = cls.camelize("id")
+ return cls._post(action="archive", data={key: model_ids})
+
+ def archive(self, reason):
+ return self.archive_many([self.id])
+
+ def unarchive(self, reason):
+ return self.unarchive_many([self.id])
+
+
+class DNASequence(ModelBase, ArchiveMixin):
+
+ def save_schema(self):
+ return self.schema(only=(
+ "aliases",
+ "annotations",
+ "bases",
+ "customFields",
+ "fields",
+ "folderId",
+ "isCircular",
+ "name",
+ "schemaId",
+ "translations"
+ ))
+
+ def update_schema(self):
+ return self.schema(only=(
+ "aliases",
+ "customFields",
+ "fields",
+ "folderId",
+ "isCircular",
+ "name",
+ "schemaId",
+ ))
+
+ # TODO: remove schema_dumper with marshmallow > 3
+ def save(self):
+ return self.create_model(self.schema_dumper(self.save_schema(), self))
+
+ # TODO: remove schema_dumper with marshmallow > 3
+ def update(self):
+ return self.update_model(self.id, self.schema_dumper(self.update_schema(), self))
+
+ @staticmethod
+ def _opensharelink(share_link):
+ """
+ Hacky way to read the contents of a Benchling share link
+ :param share_link:
+ :return:
+ """
+ # self._verifysharelink(share_link)
+ f = urlopen(share_link)
+ return f.read().decode("utf-8")
+
+ @staticmethod
+ def _parseURL(url):
+ """
+ A really hacky way to parse the Benchling api. This may become unstable.
+ :param url:
+ :return:
+ """
+ g = re.search('benchling.com/(?P\w+)/f/(?P\w+)' + \
+ '-(?P\w+)/seq-(?P\w+)-(?P' + \
+ '[a-zA-Z0-9_-]+)', url)
+ labels = ['user', 'folder_id', 'folder_name', 'seq_id', 'seq_name']
+ d = dict(list(zip(labels, g.groups())))
+ d['seq_id'] = 'seq_{}'.format(d['seq_id'])
+ return d
+
+ @classmethod
+ def from_share_link(cls, share_link):
+ seq = None
+ try:
+ text = cls._opensharelink(share_link)
+ search_pattern = "seq_\w+"
+ possible_ids = re.findall(search_pattern, text)
+ if len(possible_ids) == 0:
+ raise BenchlingAPIException("No sequence ids found in sharelink html using search pattern {}".format(
+ search_pattern))
+ uniq_ids = list(set(possible_ids))
+ if len(uniq_ids) > 1:
+ raise BenchlingAPIException("More than one possible sequence id found in sharelink html using search "
+ "pattern {}".format(search_pattern))
+ seq = uniq_ids[0]
+ except BenchlingAPIException:
+ d = cls._parseURL(share_link)
+ seq = d['seq_id']
+ if seq is None:
+ raise BenchlingAPIException("Could not find seqid in sharelink body or url.")
+ return cls.get(seq)
+
+# TODO: use alias for parameters
+class AASequence(ModelBase, ArchiveMixin):
+
+ alias = "Protein"
+
+
+class Annotation(ModelBase):
+
+ pass
+
+
+class Oligo(ModelBase):
+
+ pass
+
+
+class Translation(ModelBase):
+
+ pass
+
+
+class Folder(ModelBase, ArchiveMixin):
+
+ pass
+
+class Project(ModelBase, ArchiveMixin):
+
+ pass
+
+
+# class Annotation(ModelBase):
+#
+# pass
+
+# class UserSummary(ModelBase):
+#
+# pass
diff --git a/benchlingapi/schema.py b/benchlingapi/schema.py
new file mode 100644
index 0000000..053c7e7
--- /dev/null
+++ b/benchlingapi/schema.py
@@ -0,0 +1,142 @@
+from marshmallow import Schema, post_load, SchemaOpts, validate
+from marshmallow import fields as mfields
+from benchlingapi.models import DNASequence, AASequence
+from benchlingapi.base import ModelRegistry
+# class DefaultFieldOptions(SchemaOpts):
+#
+# allow_none = True
+# load_all = True
+
+
+class ModelSchemaMixin(object):
+ """Loads model from the Schema name"""
+
+ @classmethod
+ def get_model_name(cls):
+ return cls.__name__.split("Schema")[0]
+
+ # @classmethod
+ # def get_model(cls):
+ # model = ModelRegistry.get_model(cls.get_model_name())
+ # return model
+
+ @post_load
+ def load_model(self, data):
+ if "session" not in self.context:
+ raise Exception("Schema does not have a Session instance attached!")
+ session = self.context["session"]
+ return session.interface(self.get_model_name())(**data)
+
+
+class EntitySchema(Schema):
+ entityRegistryId = mfields.String(allow_none=True)
+ registryId = mfields.String(allow_none=True)
+ archiveRecord = mfields.Dict(allow_none=True)
+ id = mfields.String()
+ name = mfields.String(required=True)
+ createdAt = mfields.DateTime(load_only=True)
+ modifiedAt = mfields.DateTime(load_only=True)
+ creator = mfields.Dict()
+ customfields = mfields.Dict()
+ fields = mfields.Dict()
+ schemaId = mfields.String()
+ # schema = mfields.Dict(allow_none=True)
+ # schema
+ # entity
+ # archiveRecord
+ # mfields
+ # custommfields
+ webURL = mfields.URL()
+
+ class Meta:
+ additional = ("id",)
+
+
+class CustomEntity(EntitySchema):
+ aliases = mfields.List(mfields.String())
+ folderId = mfields.String(required=True)
+
+
+class SequenceSchema(EntitySchema, ModelSchemaMixin):
+ aliases = mfields.List(mfields.String())
+ folderId = mfields.String(required=True)
+ length = mfields.Integer()
+
+
+class DNASequenceSchema(SequenceSchema):
+
+ annotations = mfields.List(mfields.Nested("AnnotationSchema"))
+ bases = mfields.String(required=True)
+ isCircular = mfields.Boolean(required=True)
+ translations = mfields.List(mfields.Nested("TranslationSchema"))
+ customFields = mfields.Raw()
+
+class AASequenceSchema(SequenceSchema):
+
+ annotations = mfields.List(mfields.Nested("AnnotationSchema"))
+ aminoAcids = mfields.String(required=True)
+
+
+class OligoSchema(SequenceSchema):
+
+ bases = mfields.String(required=True)
+
+
+class BatchSchema(EntitySchema):
+
+ pass
+
+
+class AnnotationSchema(Schema):
+ color = mfields.String()
+ start = mfields.Integer()
+ end = mfields.Integer()
+ name = mfields.String()
+ strand = mfields.Integer(validate=validate.OneOf([0, 1, -1]))
+ type = mfields.String()
+
+
+class TranslationSchema(Schema):
+
+ start = mfields.Integer()
+ end = mfields.Integer()
+ strand = mfields.Integer(validate=validate.OneOf([0, 1, -1]))
+ aminoAcids = mfields.String()
+ regions = mfields.List(mfields.Dict())
+
+
+####################################
+# Common Resources
+####################################
+
+class ArchiveRecordSchema(Schema):
+ reason = mfields.String()
+
+
+class UserSummarySchema(Schema):
+
+ handle = mfields.String()
+ id = mfields.String()
+ name = mfields.String(allow_none=True)
+
+####################################
+# Projects and Folders
+####################################
+
+
+class FolderSchema(Schema, ModelSchemaMixin):
+ id = mfields.String()
+ name = mfields.String(required=True)
+ parentFolderId = mfields.String(allow_none=True)
+ projectId = mfields.String(required=True)
+ archiveRecord = mfields.Nested(ArchiveRecordSchema, allow_none=True)
+
+
+
+class ProjectSchema(Schema, ModelSchemaMixin):
+ id = mfields.String()
+ name = mfields.String()
+ owner = mfields.Nested(UserSummarySchema)
+ archiveRecord = mfields.Nested(ArchiveRecordSchema, allow_none=True)
+
+
diff --git a/benchlingapi/schemas.py b/benchlingapi/schemas.py
deleted file mode 100644
index be5fc33..0000000
--- a/benchlingapi/schemas.py
+++ /dev/null
@@ -1,509 +0,0 @@
-from marshmallow import Schema, fields, pprint, post_load
-
-from benchlingapi.models import Sequence, Folder, Annotation, Primer, Entity
-
-
-class PermissionsSchema(Schema):
- admin = fields.Boolean()
- owner = fields.Boolean()
- readable = fields.Boolean()
- writable = fields.Boolean()
- appendable = fields.Boolean()
-
-
-class EntitySchema(Schema):
- id = fields.String()
- avatarUrl = fields.URL()
- handle = fields.String()
- name = fields.String()
- type = fields.String()
- website = fields.String()
- location = fields.String()
- joined_on = fields.DateTime()
-
- @post_load
- def make(self, data):
- return Entity(**data)
-
-
-class TagSchema(Schema):
- name = fields.String()
- value = fields.String(many=True)
- url = fields.URL()
- reference = fields.String()
-
-
-class PrimerSchema(Schema):
- name = fields.String()
- bases = fields.String()
- color = fields.String()
- start = fields.Integer()
- end = fields.Integer()
- overhang_length = fields.Integer()
- strand = fields.Integer()
- created_at = fields.DateTime()
- bind_position = fields.Integer()
-
- @post_load
- def make(self, data):
- return Primer(**data)
-
-
-class AnnotationSchema(Schema):
- name = fields.String()
- strand = fields.Integer()
- color = fields.String()
- type = fields.String()
- start = fields.Integer()
- end = fields.Integer()
-
- @post_load
- def make(self, data):
- return Annotation(**data)
-
-
-class SequenceSchema(Schema):
- aliases = fields.List(fields.String)
- created_at = fields.Time()
- modified_at = fields.Time()
- creator = fields.Nested("EntitySchema")
- folder = fields.Nested("FolderSchema")
- name = fields.String()
- tags = fields.Nested("TagSchema", many=True)
- id = fields.String()
- editURL = fields.String()
- circular = fields.Boolean()
- length = fields.Integer()
- description = fields.String()
- bases = fields.String()
- annotations = fields.Nested("AnnotationSchema", many=True)
- primers = fields.Nested("PrimerSchema", many=True)
- color = fields.String()
-
- @post_load
- def make(self, data):
- return Sequence(**data)
-
-
-class FolderSchema(Schema):
- id = fields.String()
- name = fields.Str()
- description = fields.Str()
- owner = fields.Str()
- permissions = fields.Nested(PermissionsSchema)
- type = fields.Str()
- count = fields.Integer()
- created_at = fields.String()
- modified_at = fields.String()
- sequences = fields.Nested("SequenceSchema", many=True)
-
- @post_load
- def make(self, data):
- return Folder(**data)
-
-
-class ProteinSchema(Schema):
- aliases = fields.String(many=True)
- aminoAcids = fields.String()
- annotations = fields.Nested("AnnotationSchema", many=True)
- tags = fields.Nested("TagSchema", many=True)
- folder = fields.String()
- name = fields.String()
-
-
-seq = {'aliases': [],
- 'annotations': [{'color': '#FF9CCD',
- 'end': 3877,
- 'name': '1045',
- 'start': 3838,
- 'strand': -1,
- 'type': 'primer_bind'},
- {'color': '#FF9CCD',
- 'end': 3877,
- 'name': '1590 (ADH1 + tTRP1_Rev)',
- 'start': 3839,
- 'strand': -1,
- 'type': 'primer_bind'},
- {'color': '#F58A5E',
- 'end': 22,
- 'name': 'TS',
- 'start': 0,
- 'strand': 1,
- 'type': 'site'},
- {'color': '#85DAE9',
- 'end': 3877,
- 'name': "TRP1 3' UTR",
- 'start': 3831,
- 'strand': 1,
- 'type': 'terminator'},
- {'color': '#85DAE9',
- 'end': 4873,
- 'name': 'Differs from Gottschling map',
- 'start': 4872,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#F58A5E',
- 'end': 5140,
- 'name': 'Differs from Gottschling Map',
- 'start': 5139,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#B1FF67',
- 'end': 6040,
- 'name': 'EYFP',
- 'start': 5332,
- 'strand': 1,
- 'type': 'gene'},
- {'color': '#d03bff',
- 'end': 4534,
- 'name': 'GAL1',
- 'start': 4083,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#85DAE9',
- 'end': 4591,
- 'name': 'TC In Frame',
- 'start': 4589,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#85DAE9',
- 'end': 6311,
- 'name': 'CYC1_terminator',
- 'start': 6071,
- 'strand': 1,
- 'type': 'terminator'},
- {'color': '#B1FF67',
- 'end': 5278,
- 'name': 'L2',
- 'start': 5248,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#e14c73',
- 'end': 5041,
- 'name': 'IAA17 +202 to +333',
- 'start': 4909,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#cb4b2c',
- 'end': 4059,
- 'name': 'ADH1',
- 'start': 3877,
- 'strand': 1,
- 'type': 'terminator'},
- {'color': '#FF9CCD',
- 'end': 3877,
- 'name': "1589 (tTRP1 3'UTR + tADH1_Fwd)",
- 'start': 3864,
- 'strand': 1,
- 'type': 'primer_bind'},
- {'color': '#85DAE9',
- 'end': 6049,
- 'name': 'Stop Codon',
- 'start': 6046,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#004c4c',
- 'end': 2897,
- 'name': 'Amp and ori',
- 'start': 485,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#85DAE9',
- 'end': 3156,
- 'name': "TRP1 5' UTR",
- 'start': 2905,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#FFEF86',
- 'end': 6046,
- 'name': 'ORF frame 2',
- 'start': 5332,
- 'strand': -1,
- 'type': 'CDS'},
- {'color': '#FF9CCD',
- 'end': 4059,
- 'name': '1560',
- 'start': 4031,
- 'strand': -1,
- 'type': 'primer_bind'},
- {'color': '#C7B0E3',
- 'end': 4565,
- 'name': 'attR1',
- 'start': 4564,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#F58A5E',
- 'end': 2511,
- 'name': 'Ampicillin',
- 'start': 1650,
- 'strand': -1,
- 'type': 'CDS'},
- {'color': '#85DAE9',
- 'end': 4557,
- 'name': 'pBluescriptSK_Primer',
- 'start': 4540,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#FF9CCD',
- 'end': 3924,
- 'name': "1589 (tTRP1 3'UTR + tADH1_Fwd)",
- 'start': 3877,
- 'strand': 1,
- 'type': 'primer_bind'},
- {'color': '#84B0DC',
- 'end': 3877,
- 'name': 'New Feature',
- 'start': 2905,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#6c59ff',
- 'end': 5044,
- 'name': 'Extra serine, shared by VP16/hER',
- 'start': 5041,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#a17689',
- 'end': 3059,
- 'name': 'Fill-in removed EcoRI',
- 'start': 3049,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#9EAFD2',
- 'end': 6004,
- 'name': 'EGFP_C_primer',
- 'start': 5982,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#ff3e3e',
- 'end': 2581,
- 'name': 'AmpR_promoter',
- 'start': 2552,
- 'strand': -1,
- 'type': 'promoter'},
- {'color': '#F58A5E',
- 'end': 6071,
- 'name': 'TP',
- 'start': 6049,
- 'strand': 1,
- 'type': 'site'},
- {'color': '#B1FF67',
- 'end': 4872,
- 'name': 'GAL4(1-93) DBD',
- 'start': 4594,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#B1FF67',
- 'end': 2905,
- 'name': 'PmeI site',
- 'start': 2897,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#B1FF67',
- 'end': 485,
- 'name': 'PmeI site',
- 'start': 477,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#ff0000',
- 'end': 4589,
- 'name': 'attB1',
- 'start': 4565,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#84B0DC',
- 'end': 4059,
- 'name': 'New Feature',
- 'start': 3877,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#FFEF86',
- 'end': 2511,
- 'name': 'Ampicillin',
- 'start': 1650,
- 'strand': -1,
- 'type': 'gene'},
- {'color': '#FF9CCD',
- 'end': 1496,
- 'name': 'pBR322_origin',
- 'start': 876,
- 'strand': -1,
- 'type': 'rep_origin'},
- {'color': '#FFEF86',
- 'end': 6046,
- 'name': 'EYFP',
- 'start': 5332,
- 'strand': 1,
- 'type': 'CDS'},
- {'color': '#B1FF67',
- 'end': 3831,
- 'name': 'TRP1',
- 'start': 3156,
- 'strand': 1,
- 'type': 'gene'},
- {'color': '#0063ff',
- 'end': 477,
- 'name': "TRP1 3' UTR extended",
- 'start': 22,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#9EAFD2',
- 'end': 5396,
- 'name': 'EGFP_N_primer',
- 'start': 5374,
- 'strand': -1,
- 'type': 'misc_feature'},
- {'color': '#F58A5E',
- 'end': 4083,
- 'name': 'PP2',
- 'start': 4059,
- 'strand': 1,
- 'type': 'site'},
- {'color': '#FF9CCD',
- 'end': 3899,
- 'name': '1590 (ADH1 + tTRP1_Rev)',
- 'start': 3877,
- 'strand': -1,
- 'type': 'primer_bind'},
- {'color': '#85DAE9',
- 'end': 5248,
- 'name': 'HSV1 VP16',
- 'start': 5044,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#000eff',
- 'end': 4594,
- 'name': 'Yeast Kozak',
- 'start': 4591,
- 'strand': 1,
- 'type': 'misc_feature'},
- {'color': '#0d16ff',
- 'end': 5320,
- 'name': 'Double SV40',
- 'start': 5278,
- 'strand': 1,
- 'type': 'misc_feature'}],
- 'bases': 'atgtcgtaataaccccgccccgtgcaggccttttgaaaagcaagcataaaagatctaaacataaaatctgtaaaataacaagatgtaaagataatgctaaatcatttggctttttgattgattgtacaggaaaatatacatcgcagggggttgacttttaccatttcaccgcaatggaatcaaacttgttgaagagaatgttcacaggcgcatacgctacaatgacccgattcttgctagccttttctcggtcttgcaaacaaccgccggcagcttagtatataaatacacatgtacatacctctctccgtatcctcgtaatcattttcttgtatttatcgtcttttcgctgtaaaaactttatcacacttatctcaaatacacttattaaccgcttttactattatcttctacgctgacagtaatatcaaacagtgacacatattaaacacagtggtttctttgcataaacaccatgtttaaaccatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacataggagccggaagcataaagtgtaaagcctggggtgcctaatgagtgaggtaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctcggcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgttcccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactgcccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgaaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatagtttaaaccatttaatagaacagcatcgtaatatatgtgtactttgcagttatgacgccagatggcagtagtggaagatattctttattgaaaaatagcttgtcaccttacgtacaatcttgatccggagcttttctttttttgccgattaagaattaattcggtcgaaaaaagaaaaggagagggccaagagggagggcattggtgactattgagcacgtgagtatacgtgattaagcacacaaaggcagcttggagtatgtctgttattaatttcacaggtagttctggtccattggtgaaagtttgcggcttgcagagcacagaggccgcagaatgtgctctagattccgatgctgacttgctgggtattatatgtgtgcccaatagaaagagaacaattgacccggttattgcaaggaaaatttcaagtcttgtaaaagcatataaaaatagttcaggcactccgaaatacttggttggcgtgtttcgtaatcaacctaaggaggatgttttggctctggtcaatgattacggcattgatatcgtccaactgcatggagatgagtcgtggcaagaataccaagagttcctcggtttgccagttattaaaagactcgtatttccaaaagactgcaacatactactcagtgcagcttcacagaaacctcattcgtttattcccttgtttgattcagaagcaggtgggacaggtgaacttttggattggaactcgatttctgactgggttggaaggcaagagagccccgaaagcttacattttatgttagctggtggactgacgccagaaaatgttggtgatgcgcttagattaaatggcgttattggtgttgatgtaagcggaggtgtggagacaaatggtgtaaaagactctaacaaaatagcaaatttcgtcaaaaatgctaagaaataggttattactgagtagtatttatttaagtattgtttgtgcacttgccgcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctcccttaaccagattcgaaaagcggcacggattagaagccgccgagCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGaaaaaaccccggattctagaactagtggatcccccatcaCAAGTTTGTACAAAAAAGCAGGCTTCAAAATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTGggtacccctgcagctgcgtcgactctagaggatccaAGTGCTTGTCCTAAAGATCCAGCCAAACCTCCGGCCAAGGCACAAGTTGTGGGATGGCCACCGGTGAGATCATACCGGAAGAACGTGATGGTTTCCTGCCAAAAATCAAGCGGTGGCCCGGAGGCGGCGGCGtcggagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccgggtccgggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtgggggatccggttccggaagtggatccggatccCCCAAGAAGAAAAGAAAGGTCCCTAAAAAGAAACGTAAGGTTGGTGCTGGCGCCgtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaatgataccgtcgacctcgagtcaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttg',
- 'circular': True,
- 'color': '#F7977A',
- 'createdAt': '2015-10-02T17:06:12.062561+00:00',
- 'creator': {
- 'avatarUrl': 'https://main-benchling.s3.amazonaws.com/a/uTfMphp2waolQNTz7pCpuIyPuAS1VLgVRlvMBwYS/ent_A7BlnCcJTU-sunshineyyy-128.png',
- 'handle': 'sunshineyyy',
- 'id': 'ent_A7BlnCcJTU',
- 'name': 'Yaoyu Yang'},
- 'description': 'pGAL1 drive GAVNY with potential workable linker between them '
- '(pBluescriptSK + attB1) on TRP locus with TRP marker.',
- 'editURL': '/sunshineyyy/f/pP6d50rJn1-plasmids/seq-0FmHFzJe-pmodt4-pgal1-attb1-gavny/edit',
- 'folder': {'id': 'lib_pP6d50rJn1', 'name': 'Plasmids'},
- 'id': 'seq_0FmHFzJe',
- 'length': 6311,
- 'modifiedAt': '2015-10-08T18:02:51.961487+00:00',
- 'name': 'pMODT4-pGAL1-attB1-GAVNY',
- 'notes': [{'created_at': '2015-10-08T18:02:51.961487+00:00',
- 'creator': 'ent_A7BlnCcJTU',
- 'text': ''},
- {'created_at': '2015-10-08T18:02:51.961487+00:00',
- 'creator': 'ent_A7BlnCcJTU',
- 'text': ''},
- {'created_at': '2015-10-08T18:02:51.961487+00:00',
- 'creator': 'ent_A7BlnCcJTU',
- 'text': ''},
- {'created_at': '2015-10-08T18:02:51.961487+00:00',
- 'creator': 'ent_A7BlnCcJTU',
- 'text': ''}],
- 'primers': [{'bases': 'tgactcgaggtcgacggtatca',
- 'bind_position': 6049,
- 'color': '#C6C9D1',
- 'created_at': '2015-10-02T17:15:26.143628+00:00',
- 'end': 6071,
- 'name': 'TP_rev',
- 'overhang_length': 0,
- 'start': 6049,
- 'strand': -1},
- {'bases': 'AAGTTTGTACAAAAAAGCAGGCTTCAAAATGAAGCTACTGTCTTCTATCGAACAAGCATG',
- 'bind_position': 4625,
- 'color': '#FAAC61',
- 'created_at': '2015-10-02T17:14:43.317427+00:00',
- 'end': 4626,
- 'name': 'GAL4DBD_fwd_flk_attB1',
- 'overhang_length': 0,
- 'start': 4566,
- 'strand': 1}],
- 'registryId': None,
- 'tagSchema': None,
- 'tags': []}
-
-folder = {'count': 59, 'created_at': '2013-10-01T20:07:18+00:00', 'description': '', 'id': 'lib_pP6d50rJn1',
- 'modified_at': '2017-01-20T21:57:55.991758+00:00', 'name': 'Plasmids', 'owner': 'ent_A7BlnCcJTU',
- 'permissions': {'admin': True, 'appendable': True, 'owner': False, 'readable': True, 'writable': True},
- 'sequences': [{'id': 'seq_ri07UntS', 'name': 'pMODU6-pGPD-EYFP'},
- {'id': 'seq_2MFFshfl', 'name': 'pYMOD2Kmx_pGAL1-HYG_ZEV4-cassette'},
- {'id': 'seq_ztl4dnOW', 'name': 'pLAB1'},
- {'id': 'seq_vA5dxrqd', 'name': 'pMODU6-pGALZ4-AlphaFactor'},
- {'id': 'seq_okitCPyx', 'name': 'pGPT4-pGAL1-GAVNY(VP64)'},
- {'id': 'seq_7yXay7Ep', 'name': 'pGP8G-TIR1-Y'},
- {'id': 'seq_7O7ThYSI', 'name': 'pMODU6-pGALZ4-Z4AVNY'},
- {'id': 'seq_t77GYXRB', 'name': 'pGPT4-pGAL1-EGFP'},
- {'id': 'seq_mfMW58Dd', 'name': 'pGPL5G-pGALZ4-URA3'},
- {'id': 'seq_beOWphBv', 'name': 'pMODKan-HO-pACT1-ZEV4'},
- {'id': 'seq_0FmHFzJe', 'name': 'pMODT4-pGAL1-attB1-GAVNY'},
- {'id': 'seq_Nv6wYspV', 'name': 'FAR1-mut-87aa-TP'},
- {'id': 'seq_5bmPzcKN', 'name': 'pMODU6-pGALZ4-NatMX'},
- {'id': 'seq_f4GgnFdY', 'name': 'pGPT4-pGAL1-GAVNY_seq_verified'},
- {'id': 'seq_QteKmJdS', 'name': 'pGPT4-pGAL1-GAVNY_mutated_library'},
- {'id': 'seq_5HcRWKi8', 'name': 'pMODU6-pGALZ4-P1G1-HygMX'},
- {'id': 'seq_IyZI9bEh', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T1_opt'},
- {'id': 'seq_iGdjEEx4', 'name': 'pGPT4-pGAL1-P1G1-GEV'}, {'id': 'seq_AgQ1w9ak', 'name': 'pLAB2'},
- {'id': 'seq_QuWMpfRK', 'name': 'pMODT4-pGAL1-attB1-GVNY'},
- {'id': 'seq_etTsAfD4', 'name': 'pGPU6-pGALZ4-eYFP'},
- {'id': 'seq_5AXMlSvB', 'name': 'pYMOD2Kmx_pGAL1-HYG_pGAL1-iaah'},
- {'id': 'seq_K5hwGNwg', 'name': 'pMODU6-pGAL1-BleoMX'},
- {'id': 'seq_Na2oNxzs', 'name': 'pMODU6-pGALZ4-FAR1-mut-87aa'},
- {'id': 'seq_2rKmILGU', 'name': 'pMODU6-pGAL1-NatMX'},
- {'id': 'seq_qihkmlW4', 'name': 'pMODU6-pGAL1-AlphaFactor'},
- {'id': 'seq_rwDoRd9Q', 'name': 'pMODU6-pGALZ4-FAR1'},
- {'id': 'seq_QGfqobtP', 'name': 'pGPT4-pGAL1-AVNY'},
- {'id': 'seq_hhI5TTbO', 'name': 'pMODU6-pGAL1-FAR1-IAA17T2'},
- {'id': 'seq_tMz0Xv3g', 'name': 'pMODU6-pGAL1-FAR1-L1-IAA17T2'},
- {'id': 'seq_PKJNfuZA', 'name': 'pGPH8-pGAL1-GAVNY_v2'},
- {'id': 'seq_4ccBmI1j', 'name': 'pGPU6-pGAL1-AFB2'},
- {'id': 'seq_Qc6f2Kii', 'name': 'pMOD4G-NLS_dCas9_VP64'},
- {'id': 'seq_k0MuYdIM', 'name': 'pMODU6-pGAL1-IAA17T2-FAR1'},
- {'id': 'seq_F4tEc0XU', 'name': 'pMODU6-pGALZ4-STE5(-)RING'},
- {'id': 'seq_2xGw2yCj', 'name': 'pGPH8-pGAL1-GAVNY'},
- {'id': 'seq_9ph0SnJV', 'name': 'AmpR-T4-pGAL1-GAL4DBD-L1'},
- {'id': 'seq_D1iAdKMz', 'name': 'pGPL5G-pGAL1-URA3'},
- {'id': 'seq_wHiaXdFM', 'name': 'pGPT4-pGAL1-G(m)AVNY'},
- {'id': 'seq_VazadBJw', 'name': 'pGPT4-pGAL1-GAVNY'},
- {'id': 'seq_w2IZPFzd', 'name': 'pMODOK-pACT1-GAVNY'},
- {'id': 'seq_fkFjzKkb', 'name': 'v63_pGP8zGAL-STE5(-)RING-SNC2 C-term'},
- {'id': 'seq_i0Yl6uzk', 'name': 'pMODH8-pGPD-TIR1_DM'},
- {'id': 'seq_m42PVReQ', 'name': 'pMODT4-pGALZ4-Z4AVNY'},
- {'id': 'seq_WQ0wqb9f', 'name': 'pMODU6-pGALZ4-iaaH'},
- {'id': 'seq_l5VHTc8Z', 'name': 'pGPU6-pGAL1-TIR1_DM'},
- {'id': 'seq_kKtPZ1Rs', 'name': 'pMODT4-pGAL1-P1G1-GAVNY'},
- {'id': 'seq_usn0K27s', 'name': 'pMODU6-pGALZ4-BleoMX'},
- {'id': 'seq_rzQGBzv2', 'name': 'pGP5G-ccdB'},
- {'id': 'seq_bw3XWuZU', 'name': 'pMODT4-pGALZ4-AVNY'},
- {'id': 'seq_SGfG2YeB', 'name': 'pMODU6-pGALZ4-HygMX'},
- {'id': 'seq_TWAJLtvz', 'name': 'pMODU6-pGAL1-P1G1-HygMX'},
- {'id': 'seq_tFGIIL0C', 'name': 'pMODU6-pGAL1-FAR1'},
- {'id': 'seq_6VN5FDpP', 'name': 'pMODOK-pACT1-GAVN'},
- {'id': 'seq_y9xdtVx7', 'name': 'pMODKan-HO-pACT1GEV'},
- {'id': 'seq_AyQ7ToIn', 'name': 'pBR322 (Sample Sequence)'},
- {'id': 'seq_GuqSGBXY', 'name': 'pGPT4-pGAL1-GAVNY(VP64) new design'},
- {'id': 'seq_UbsucV1t', 'name': 'pMODU6-pGAL1-HygMX'},
- {'id': 'seq_TsTM0B8q', 'name': 'pMOD4-pGAL1Z3(P3)-MF(AL'}], 'type': 'ALL'}
-
-schema = SequenceSchema()
-data = schema.load(seq)
-pprint(data.errors)
-pprint(data.data)
-
-seq = data.data
-schema.dump(seq)
-
-schema = FolderSchema()
-data = schema.load(folder)
-pprint(data.errors)
-pprint(data.data)
diff --git a/benchlingapi/session.py b/benchlingapi/session.py
new file mode 100644
index 0000000..60f1b40
--- /dev/null
+++ b/benchlingapi/session.py
@@ -0,0 +1,123 @@
+import requests
+from benchlingapi.exceptions import BenchlingAPIException, ModelNotFoundError
+import json
+from benchlingapi.base import ModelRegistry
+from benchlingapi.models import __all__ as allmodels
+from benchlingapi.utils import url_build
+from functools import partial, wraps
+
+
+class RequestDecorator(object):
+ """
+ Wraps a function to raise error with unexpected request status codes
+ """
+ def __init__(self, status_codes):
+ if not isinstance(status_codes, list):
+ status_codes = [status_codes]
+ self.code = status_codes
+
+ def __call__(self, f):
+ @wraps(f)
+ def wrapped_f(*args, **kwargs):
+ r = f(*args, **kwargs)
+ if r.status_code not in self.code:
+ http_codes = {
+ 400: "BAD REQUEST",
+ 403: "FORBIDDEN",
+ 404: "NOT FOUND",
+ 500: "INTERNAL SERVER ERROR",
+ 503: "SERVICE UNAVAILABLE",
+ 504: "SERVER TIMEOUT"}
+ msg = ""
+ if r.status_code in http_codes:
+ msg = http_codes[r.status_code]
+ msg += f"\nrequest: {r.request}"
+ msg += f"\nurl: {r.request.path_url}"
+ msg += f"\nresponse: {r.text}"
+ raise BenchlingAPIException("HTTP Response Failed {} {}".format(
+ r.status_code, msg))
+ return r.json()
+
+ return wrapped_f
+
+
+class Http(object):
+ TIMEOUT = 30
+ HOME = 'https://benchling.com/api/v2'
+ NEXT = "nextToken"
+
+ def __init__(self, api_key):
+ session = requests.Session()
+ session.auth = (api_key, '')
+ self.__session = session
+ self.post = RequestDecorator([200, 201, 202])(partial(self.request, "post"))
+ self.get = RequestDecorator(200)(partial(self.request, "get"))
+ self.delete = RequestDecorator(200)(partial(self.request, "delete"))
+ self.patch = RequestDecorator([200, 201])(partial(self.request, "patch"))
+
+ def request(self, method, path, timeout=None, action=None, **kwargs):
+ if timeout is None:
+ timeout = self.TIMEOUT
+ if action is not None:
+ path += ":" + action
+ return self.__session.request(method, url_build(self.HOME, path), timeout=timeout, **kwargs)
+
+ def get_pages(self, path, timeout=None, action=None, **kwargs):
+ get_response = partial(self.get, path, timeout=timeout, action=action)
+
+ response = get_response(**kwargs)
+
+ while response is not None:
+ yield response
+
+ next = response.get(self.NEXT, None)
+
+ # update params with nextToken
+ params = kwargs.get(self.NEXT, {})
+ params.update({self.NEXT: next})
+ kwargs["params"] = params
+
+ if next is not None:
+ response = get_response(**kwargs)
+ else:
+ response = None
+
+
+class Session(object):
+
+ def __init__(self, api_key):
+ self.__http = Http(api_key)
+ self.__interfaces = {}
+ for model_name in allmodels:
+ model_cls = ModelRegistry.get_model(model_name)
+ nmspc = {"session": self}
+ # if model_cls.blacklist is not None:
+ # for blacklisted_method in model_cls.blacklist:
+ # nmspc[blacklisted_method] = None
+ mymodel = type(model_name, (model_cls,), nmspc)
+ setattr(self, model_name, mymodel)
+ self.__interfaces[model_name] = mymodel
+
+ @property
+ def http(self):
+ return self.__http
+
+ @property
+ def url(self):
+ return self.__http.HOME
+
+ @property
+ def models(self):
+ return list(ModelRegistry.models.keys())
+
+ def set_timeout(self, timeout_in_seconds):
+ self.__http.timeout = timeout_in_seconds
+
+ @property
+ def interfaces(self):
+ return self.__interfaces
+
+ def interface(self, model_name):
+ if model_name not in self.interfaces:
+ raise ModelNotFoundError("No model by name of \"{}\"".format(model_name))
+ return self.interfaces[model_name]
\ No newline at end of file
diff --git a/benchlingapi/utils.py b/benchlingapi/utils.py
new file mode 100644
index 0000000..9017071
--- /dev/null
+++ b/benchlingapi/utils.py
@@ -0,0 +1,3 @@
+def url_build(*parts):
+ """Join parts of a url into a string"""
+ return '/'.join(p.strip('/') for p in parts)
\ No newline at end of file
diff --git a/docs/.buildinfo b/docs/.buildinfo
new file mode 100644
index 0000000..052ea82
--- /dev/null
+++ b/docs/.buildinfo
@@ -0,0 +1,4 @@
+# Sphinx build info version 1
+# This file hashes the configuration used when building these files. When it is not found, a full rebuild will be done.
+config: d515c89a82f6c0eedbd624ff7531bf9e
+tags: 645f666f9bcd5a90fca523b33c5a78b7
diff --git a/docs/.doctrees/environment.pickle b/docs/.doctrees/environment.pickle
new file mode 100644
index 0000000..d4a8a70
Binary files /dev/null and b/docs/.doctrees/environment.pickle differ
diff --git a/docs/.doctrees/index.doctree b/docs/.doctrees/index.doctree
new file mode 100644
index 0000000..d6a6455
Binary files /dev/null and b/docs/.doctrees/index.doctree differ
diff --git a/tests/__init__.py b/docs/.nojekyll
similarity index 100%
rename from tests/__init__.py
rename to docs/.nojekyll
diff --git a/docs/_sources/index.rst.txt b/docs/_sources/index.rst.txt
new file mode 100644
index 0000000..6618e3e
--- /dev/null
+++ b/docs/_sources/index.rst.txt
@@ -0,0 +1,20 @@
+.. BenchlingPyAPI documentation master file, created by
+ sphinx-quickstart on Mon Jul 16 10:09:33 2018.
+ You can adapt this file completely to your liking, but it should at least
+ contain the root `toctree` directive.
+
+Welcome to BenchlingPyAPI's documentation!
+==========================================
+
+.. toctree::
+ :maxdepth: 2
+ :caption: Contents:
+
+
+
+Indices and tables
+==================
+
+* :ref:`genindex`
+* :ref:`modindex`
+* :ref:`search`
diff --git a/docs/_static/ajax-loader.gif b/docs/_static/ajax-loader.gif
new file mode 100644
index 0000000..61faf8c
Binary files /dev/null and b/docs/_static/ajax-loader.gif differ
diff --git a/docs/_static/alabaster.css b/docs/_static/alabaster.css
new file mode 100644
index 0000000..25e7738
--- /dev/null
+++ b/docs/_static/alabaster.css
@@ -0,0 +1,688 @@
+@import url("basic.css");
+
+/* -- page layout ----------------------------------------------------------- */
+
+body {
+ font-family: Georgia, serif;
+ font-size: 17px;
+ background-color: #fff;
+ color: #000;
+ margin: 0;
+ padding: 0;
+}
+
+
+div.document {
+ width: 940px;
+ margin: 30px auto 0 auto;
+}
+
+div.documentwrapper {
+ float: left;
+ width: 100%;
+}
+
+div.bodywrapper {
+ margin: 0 0 0 220px;
+}
+
+div.sphinxsidebar {
+ width: 220px;
+ font-size: 14px;
+ line-height: 1.5;
+}
+
+hr {
+ border: 1px solid #B1B4B6;
+}
+
+div.body {
+ background-color: #fff;
+ color: #3E4349;
+ padding: 0 30px 0 30px;
+}
+
+div.body > .section {
+ text-align: left;
+}
+
+div.footer {
+ width: 940px;
+ margin: 20px auto 30px auto;
+ font-size: 14px;
+ color: #888;
+ text-align: right;
+}
+
+div.footer a {
+ color: #888;
+}
+
+p.caption {
+ font-family: inherit;
+ font-size: inherit;
+}
+
+
+div.relations {
+ display: none;
+}
+
+
+div.sphinxsidebar a {
+ color: #444;
+ text-decoration: none;
+ border-bottom: 1px dotted #999;
+}
+
+div.sphinxsidebar a:hover {
+ border-bottom: 1px solid #999;
+}
+
+div.sphinxsidebarwrapper {
+ padding: 18px 10px;
+}
+
+div.sphinxsidebarwrapper p.logo {
+ padding: 0;
+ margin: -10px 0 0 0px;
+ text-align: center;
+}
+
+div.sphinxsidebarwrapper h1.logo {
+ margin-top: -10px;
+ text-align: center;
+ margin-bottom: 5px;
+ text-align: left;
+}
+
+div.sphinxsidebarwrapper h1.logo-name {
+ margin-top: 0px;
+}
+
+div.sphinxsidebarwrapper p.blurb {
+ margin-top: 0;
+ font-style: normal;
+}
+
+div.sphinxsidebar h3,
+div.sphinxsidebar h4 {
+ font-family: Georgia, serif;
+ color: #444;
+ font-size: 24px;
+ font-weight: normal;
+ margin: 0 0 5px 0;
+ padding: 0;
+}
+
+div.sphinxsidebar h4 {
+ font-size: 20px;
+}
+
+div.sphinxsidebar h3 a {
+ color: #444;
+}
+
+div.sphinxsidebar p.logo a,
+div.sphinxsidebar h3 a,
+div.sphinxsidebar p.logo a:hover,
+div.sphinxsidebar h3 a:hover {
+ border: none;
+}
+
+div.sphinxsidebar p {
+ color: #555;
+ margin: 10px 0;
+}
+
+div.sphinxsidebar ul {
+ margin: 10px 0;
+ padding: 0;
+ color: #000;
+}
+
+div.sphinxsidebar ul li.toctree-l1 > a {
+ font-size: 120%;
+}
+
+div.sphinxsidebar ul li.toctree-l2 > a {
+ font-size: 110%;
+}
+
+div.sphinxsidebar input {
+ border: 1px solid #CCC;
+ font-family: Georgia, serif;
+ font-size: 1em;
+}
+
+div.sphinxsidebar hr {
+ border: none;
+ height: 1px;
+ color: #AAA;
+ background: #AAA;
+
+ text-align: left;
+ margin-left: 0;
+ width: 50%;
+}
+
+/* -- body styles ----------------------------------------------------------- */
+
+a {
+ color: #004B6B;
+ text-decoration: underline;
+}
+
+a:hover {
+ color: #6D4100;
+ text-decoration: underline;
+}
+
+div.body h1,
+div.body h2,
+div.body h3,
+div.body h4,
+div.body h5,
+div.body h6 {
+ font-family: Georgia, serif;
+ font-weight: normal;
+ margin: 30px 0px 10px 0px;
+ padding: 0;
+}
+
+div.body h1 { margin-top: 0; padding-top: 0; font-size: 240%; }
+div.body h2 { font-size: 180%; }
+div.body h3 { font-size: 150%; }
+div.body h4 { font-size: 130%; }
+div.body h5 { font-size: 100%; }
+div.body h6 { font-size: 100%; }
+
+a.headerlink {
+ color: #DDD;
+ padding: 0 4px;
+ text-decoration: none;
+}
+
+a.headerlink:hover {
+ color: #444;
+ background: #EAEAEA;
+}
+
+div.body p, div.body dd, div.body li {
+ line-height: 1.4em;
+}
+
+div.admonition {
+ margin: 20px 0px;
+ padding: 10px 30px;
+ background-color: #EEE;
+ border: 1px solid #CCC;
+}
+
+div.admonition tt.xref, div.admonition code.xref, div.admonition a tt {
+ background-color: #FBFBFB;
+ border-bottom: 1px solid #fafafa;
+}
+
+div.admonition p.admonition-title {
+ font-family: Georgia, serif;
+ font-weight: normal;
+ font-size: 24px;
+ margin: 0 0 10px 0;
+ padding: 0;
+ line-height: 1;
+}
+
+div.admonition p.last {
+ margin-bottom: 0;
+}
+
+div.highlight {
+ background-color: #fff;
+}
+
+dt:target, .highlight {
+ background: #FAF3E8;
+}
+
+div.warning {
+ background-color: #FCC;
+ border: 1px solid #FAA;
+}
+
+div.danger {
+ background-color: #FCC;
+ border: 1px solid #FAA;
+ -moz-box-shadow: 2px 2px 4px #D52C2C;
+ -webkit-box-shadow: 2px 2px 4px #D52C2C;
+ box-shadow: 2px 2px 4px #D52C2C;
+}
+
+div.error {
+ background-color: #FCC;
+ border: 1px solid #FAA;
+ -moz-box-shadow: 2px 2px 4px #D52C2C;
+ -webkit-box-shadow: 2px 2px 4px #D52C2C;
+ box-shadow: 2px 2px 4px #D52C2C;
+}
+
+div.caution {
+ background-color: #FCC;
+ border: 1px solid #FAA;
+}
+
+div.attention {
+ background-color: #FCC;
+ border: 1px solid #FAA;
+}
+
+div.important {
+ background-color: #EEE;
+ border: 1px solid #CCC;
+}
+
+div.note {
+ background-color: #EEE;
+ border: 1px solid #CCC;
+}
+
+div.tip {
+ background-color: #EEE;
+ border: 1px solid #CCC;
+}
+
+div.hint {
+ background-color: #EEE;
+ border: 1px solid #CCC;
+}
+
+div.seealso {
+ background-color: #EEE;
+ border: 1px solid #CCC;
+}
+
+div.topic {
+ background-color: #EEE;
+}
+
+p.admonition-title {
+ display: inline;
+}
+
+p.admonition-title:after {
+ content: ":";
+}
+
+pre, tt, code {
+ font-family: 'Consolas', 'Menlo', 'Deja Vu Sans Mono', 'Bitstream Vera Sans Mono', monospace;
+ font-size: 0.9em;
+}
+
+.hll {
+ background-color: #FFC;
+ margin: 0 -12px;
+ padding: 0 12px;
+ display: block;
+}
+
+img.screenshot {
+}
+
+tt.descname, tt.descclassname, code.descname, code.descclassname {
+ font-size: 0.95em;
+}
+
+tt.descname, code.descname {
+ padding-right: 0.08em;
+}
+
+img.screenshot {
+ -moz-box-shadow: 2px 2px 4px #EEE;
+ -webkit-box-shadow: 2px 2px 4px #EEE;
+ box-shadow: 2px 2px 4px #EEE;
+}
+
+table.docutils {
+ border: 1px solid #888;
+ -moz-box-shadow: 2px 2px 4px #EEE;
+ -webkit-box-shadow: 2px 2px 4px #EEE;
+ box-shadow: 2px 2px 4px #EEE;
+}
+
+table.docutils td, table.docutils th {
+ border: 1px solid #888;
+ padding: 0.25em 0.7em;
+}
+
+table.field-list, table.footnote {
+ border: none;
+ -moz-box-shadow: none;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+}
+
+table.footnote {
+ margin: 15px 0;
+ width: 100%;
+ border: 1px solid #EEE;
+ background: #FDFDFD;
+ font-size: 0.9em;
+}
+
+table.footnote + table.footnote {
+ margin-top: -15px;
+ border-top: none;
+}
+
+table.field-list th {
+ padding: 0 0.8em 0 0;
+}
+
+table.field-list td {
+ padding: 0;
+}
+
+table.field-list p {
+ margin-bottom: 0.8em;
+}
+
+/* Cloned from
+ * https://github.com/sphinx-doc/sphinx/commit/ef60dbfce09286b20b7385333d63a60321784e68
+ */
+.field-name {
+ -moz-hyphens: manual;
+ -ms-hyphens: manual;
+ -webkit-hyphens: manual;
+ hyphens: manual;
+}
+
+table.footnote td.label {
+ width: .1px;
+ padding: 0.3em 0 0.3em 0.5em;
+}
+
+table.footnote td {
+ padding: 0.3em 0.5em;
+}
+
+dl {
+ margin: 0;
+ padding: 0;
+}
+
+dl dd {
+ margin-left: 30px;
+}
+
+blockquote {
+ margin: 0 0 0 30px;
+ padding: 0;
+}
+
+ul, ol {
+ /* Matches the 30px from the narrow-screen "li > ul" selector below */
+ margin: 10px 0 10px 30px;
+ padding: 0;
+}
+
+pre {
+ background: #EEE;
+ padding: 7px 30px;
+ margin: 15px 0px;
+ line-height: 1.3em;
+}
+
+div.viewcode-block:target {
+ background: #ffd;
+}
+
+dl pre, blockquote pre, li pre {
+ margin-left: 0;
+ padding-left: 30px;
+}
+
+tt, code {
+ background-color: #ecf0f3;
+ color: #222;
+ /* padding: 1px 2px; */
+}
+
+tt.xref, code.xref, a tt {
+ background-color: #FBFBFB;
+ border-bottom: 1px solid #fff;
+}
+
+a.reference {
+ text-decoration: none;
+ border-bottom: 1px dotted #004B6B;
+}
+
+/* Don't put an underline on images */
+a.image-reference, a.image-reference:hover {
+ border-bottom: none;
+}
+
+a.reference:hover {
+ border-bottom: 1px solid #6D4100;
+}
+
+a.footnote-reference {
+ text-decoration: none;
+ font-size: 0.7em;
+ vertical-align: top;
+ border-bottom: 1px dotted #004B6B;
+}
+
+a.footnote-reference:hover {
+ border-bottom: 1px solid #6D4100;
+}
+
+a:hover tt, a:hover code {
+ background: #EEE;
+}
+
+
+@media screen and (max-width: 870px) {
+
+ div.sphinxsidebar {
+ display: none;
+ }
+
+ div.document {
+ width: 100%;
+
+ }
+
+ div.documentwrapper {
+ margin-left: 0;
+ margin-top: 0;
+ margin-right: 0;
+ margin-bottom: 0;
+ }
+
+ div.bodywrapper {
+ margin-top: 0;
+ margin-right: 0;
+ margin-bottom: 0;
+ margin-left: 0;
+ }
+
+ ul {
+ margin-left: 0;
+ }
+
+ li > ul {
+ /* Matches the 30px from the "ul, ol" selector above */
+ margin-left: 30px;
+ }
+
+ .document {
+ width: auto;
+ }
+
+ .footer {
+ width: auto;
+ }
+
+ .bodywrapper {
+ margin: 0;
+ }
+
+ .footer {
+ width: auto;
+ }
+
+ .github {
+ display: none;
+ }
+
+
+
+}
+
+
+
+@media screen and (max-width: 875px) {
+
+ body {
+ margin: 0;
+ padding: 20px 30px;
+ }
+
+ div.documentwrapper {
+ float: none;
+ background: #fff;
+ }
+
+ div.sphinxsidebar {
+ display: block;
+ float: none;
+ width: 102.5%;
+ margin: 50px -30px -20px -30px;
+ padding: 10px 20px;
+ background: #333;
+ color: #FFF;
+ }
+
+ div.sphinxsidebar h3, div.sphinxsidebar h4, div.sphinxsidebar p,
+ div.sphinxsidebar h3 a {
+ color: #fff;
+ }
+
+ div.sphinxsidebar a {
+ color: #AAA;
+ }
+
+ div.sphinxsidebar p.logo {
+ display: none;
+ }
+
+ div.document {
+ width: 100%;
+ margin: 0;
+ }
+
+ div.footer {
+ display: none;
+ }
+
+ div.bodywrapper {
+ margin: 0;
+ }
+
+ div.body {
+ min-height: 0;
+ padding: 0;
+ }
+
+ .rtd_doc_footer {
+ display: none;
+ }
+
+ .document {
+ width: auto;
+ }
+
+ .footer {
+ width: auto;
+ }
+
+ .footer {
+ width: auto;
+ }
+
+ .github {
+ display: none;
+ }
+}
+
+
+/* misc. */
+
+.revsys-inline {
+ display: none!important;
+}
+
+/* Make nested-list/multi-paragraph items look better in Releases changelog
+ * pages. Without this, docutils' magical list fuckery causes inconsistent
+ * formatting between different release sub-lists.
+ */
+div#changelog > div.section > ul > li > p:only-child {
+ margin-bottom: 0;
+}
+
+/* Hide fugly table cell borders in ..bibliography:: directive output */
+table.docutils.citation, table.docutils.citation td, table.docutils.citation th {
+ border: none;
+ /* Below needed in some edge cases; if not applied, bottom shadows appear */
+ -moz-box-shadow: none;
+ -webkit-box-shadow: none;
+ box-shadow: none;
+}
+
+
+/* relbar */
+
+.related {
+ line-height: 30px;
+ width: 100%;
+ font-size: 0.9rem;
+}
+
+.related.top {
+ border-bottom: 1px solid #EEE;
+ margin-bottom: 20px;
+}
+
+.related.bottom {
+ border-top: 1px solid #EEE;
+}
+
+.related ul {
+ padding: 0;
+ margin: 0;
+ list-style: none;
+}
+
+.related li {
+ display: inline;
+}
+
+nav#rellinks {
+ float: right;
+}
+
+nav#rellinks li+li:before {
+ content: "|";
+}
+
+nav#breadcrumbs li+li:before {
+ content: "\00BB";
+}
+
+/* Hide certain items when printing */
+@media print {
+ div.related {
+ display: none;
+ }
+}
\ No newline at end of file
diff --git a/docs/_static/basic.css b/docs/_static/basic.css
new file mode 100644
index 0000000..19ced10
--- /dev/null
+++ b/docs/_static/basic.css
@@ -0,0 +1,665 @@
+/*
+ * basic.css
+ * ~~~~~~~~~
+ *
+ * Sphinx stylesheet -- basic theme.
+ *
+ * :copyright: Copyright 2007-2018 by the Sphinx team, see AUTHORS.
+ * :license: BSD, see LICENSE for details.
+ *
+ */
+
+/* -- main layout ----------------------------------------------------------- */
+
+div.clearer {
+ clear: both;
+}
+
+/* -- relbar ---------------------------------------------------------------- */
+
+div.related {
+ width: 100%;
+ font-size: 90%;
+}
+
+div.related h3 {
+ display: none;
+}
+
+div.related ul {
+ margin: 0;
+ padding: 0 0 0 10px;
+ list-style: none;
+}
+
+div.related li {
+ display: inline;
+}
+
+div.related li.right {
+ float: right;
+ margin-right: 5px;
+}
+
+/* -- sidebar --------------------------------------------------------------- */
+
+div.sphinxsidebarwrapper {
+ padding: 10px 5px 0 10px;
+}
+
+div.sphinxsidebar {
+ float: left;
+ width: 230px;
+ margin-left: -100%;
+ font-size: 90%;
+ word-wrap: break-word;
+ overflow-wrap : break-word;
+}
+
+div.sphinxsidebar ul {
+ list-style: none;
+}
+
+div.sphinxsidebar ul ul,
+div.sphinxsidebar ul.want-points {
+ margin-left: 20px;
+ list-style: square;
+}
+
+div.sphinxsidebar ul ul {
+ margin-top: 0;
+ margin-bottom: 0;
+}
+
+div.sphinxsidebar form {
+ margin-top: 10px;
+}
+
+div.sphinxsidebar input {
+ border: 1px solid #98dbcc;
+ font-family: sans-serif;
+ font-size: 1em;
+}
+
+div.sphinxsidebar #searchbox input[type="text"] {
+ float: left;
+ width: 80%;
+ padding: 0.25em;
+ box-sizing: border-box;
+}
+
+div.sphinxsidebar #searchbox input[type="submit"] {
+ float: left;
+ width: 20%;
+ border-left: none;
+ padding: 0.25em;
+ box-sizing: border-box;
+}
+
+
+img {
+ border: 0;
+ max-width: 100%;
+}
+
+/* -- search page ----------------------------------------------------------- */
+
+ul.search {
+ margin: 10px 0 0 20px;
+ padding: 0;
+}
+
+ul.search li {
+ padding: 5px 0 5px 20px;
+ background-image: url(file.png);
+ background-repeat: no-repeat;
+ background-position: 0 7px;
+}
+
+ul.search li a {
+ font-weight: bold;
+}
+
+ul.search li div.context {
+ color: #888;
+ margin: 2px 0 0 30px;
+ text-align: left;
+}
+
+ul.keywordmatches li.goodmatch a {
+ font-weight: bold;
+}
+
+/* -- index page ------------------------------------------------------------ */
+
+table.contentstable {
+ width: 90%;
+ margin-left: auto;
+ margin-right: auto;
+}
+
+table.contentstable p.biglink {
+ line-height: 150%;
+}
+
+a.biglink {
+ font-size: 1.3em;
+}
+
+span.linkdescr {
+ font-style: italic;
+ padding-top: 5px;
+ font-size: 90%;
+}
+
+/* -- general index --------------------------------------------------------- */
+
+table.indextable {
+ width: 100%;
+}
+
+table.indextable td {
+ text-align: left;
+ vertical-align: top;
+}
+
+table.indextable ul {
+ margin-top: 0;
+ margin-bottom: 0;
+ list-style-type: none;
+}
+
+table.indextable > tbody > tr > td > ul {
+ padding-left: 0em;
+}
+
+table.indextable tr.pcap {
+ height: 10px;
+}
+
+table.indextable tr.cap {
+ margin-top: 10px;
+ background-color: #f2f2f2;
+}
+
+img.toggler {
+ margin-right: 3px;
+ margin-top: 3px;
+ cursor: pointer;
+}
+
+div.modindex-jumpbox {
+ border-top: 1px solid #ddd;
+ border-bottom: 1px solid #ddd;
+ margin: 1em 0 1em 0;
+ padding: 0.4em;
+}
+
+div.genindex-jumpbox {
+ border-top: 1px solid #ddd;
+ border-bottom: 1px solid #ddd;
+ margin: 1em 0 1em 0;
+ padding: 0.4em;
+}
+
+/* -- domain module index --------------------------------------------------- */
+
+table.modindextable td {
+ padding: 2px;
+ border-collapse: collapse;
+}
+
+/* -- general body styles --------------------------------------------------- */
+
+div.body {
+ min-width: 450px;
+ max-width: 800px;
+}
+
+div.body p, div.body dd, div.body li, div.body blockquote {
+ -moz-hyphens: auto;
+ -ms-hyphens: auto;
+ -webkit-hyphens: auto;
+ hyphens: auto;
+}
+
+a.headerlink {
+ visibility: hidden;
+}
+
+h1:hover > a.headerlink,
+h2:hover > a.headerlink,
+h3:hover > a.headerlink,
+h4:hover > a.headerlink,
+h5:hover > a.headerlink,
+h6:hover > a.headerlink,
+dt:hover > a.headerlink,
+caption:hover > a.headerlink,
+p.caption:hover > a.headerlink,
+div.code-block-caption:hover > a.headerlink {
+ visibility: visible;
+}
+
+div.body p.caption {
+ text-align: inherit;
+}
+
+div.body td {
+ text-align: left;
+}
+
+.first {
+ margin-top: 0 !important;
+}
+
+p.rubric {
+ margin-top: 30px;
+ font-weight: bold;
+}
+
+img.align-left, .figure.align-left, object.align-left {
+ clear: left;
+ float: left;
+ margin-right: 1em;
+}
+
+img.align-right, .figure.align-right, object.align-right {
+ clear: right;
+ float: right;
+ margin-left: 1em;
+}
+
+img.align-center, .figure.align-center, object.align-center {
+ display: block;
+ margin-left: auto;
+ margin-right: auto;
+}
+
+.align-left {
+ text-align: left;
+}
+
+.align-center {
+ text-align: center;
+}
+
+.align-right {
+ text-align: right;
+}
+
+/* -- sidebars -------------------------------------------------------------- */
+
+div.sidebar {
+ margin: 0 0 0.5em 1em;
+ border: 1px solid #ddb;
+ padding: 7px 7px 0 7px;
+ background-color: #ffe;
+ width: 40%;
+ float: right;
+}
+
+p.sidebar-title {
+ font-weight: bold;
+}
+
+/* -- topics ---------------------------------------------------------------- */
+
+div.topic {
+ border: 1px solid #ccc;
+ padding: 7px 7px 0 7px;
+ margin: 10px 0 10px 0;
+}
+
+p.topic-title {
+ font-size: 1.1em;
+ font-weight: bold;
+ margin-top: 10px;
+}
+
+/* -- admonitions ----------------------------------------------------------- */
+
+div.admonition {
+ margin-top: 10px;
+ margin-bottom: 10px;
+ padding: 7px;
+}
+
+div.admonition dt {
+ font-weight: bold;
+}
+
+div.admonition dl {
+ margin-bottom: 0;
+}
+
+p.admonition-title {
+ margin: 0px 10px 5px 0px;
+ font-weight: bold;
+}
+
+div.body p.centered {
+ text-align: center;
+ margin-top: 25px;
+}
+
+/* -- tables ---------------------------------------------------------------- */
+
+table.docutils {
+ border: 0;
+ border-collapse: collapse;
+}
+
+table.align-center {
+ margin-left: auto;
+ margin-right: auto;
+}
+
+table caption span.caption-number {
+ font-style: italic;
+}
+
+table caption span.caption-text {
+}
+
+table.docutils td, table.docutils th {
+ padding: 1px 8px 1px 5px;
+ border-top: 0;
+ border-left: 0;
+ border-right: 0;
+ border-bottom: 1px solid #aaa;
+}
+
+table.footnote td, table.footnote th {
+ border: 0 !important;
+}
+
+th {
+ text-align: left;
+ padding-right: 5px;
+}
+
+table.citation {
+ border-left: solid 1px gray;
+ margin-left: 1px;
+}
+
+table.citation td {
+ border-bottom: none;
+}
+
+/* -- figures --------------------------------------------------------------- */
+
+div.figure {
+ margin: 0.5em;
+ padding: 0.5em;
+}
+
+div.figure p.caption {
+ padding: 0.3em;
+}
+
+div.figure p.caption span.caption-number {
+ font-style: italic;
+}
+
+div.figure p.caption span.caption-text {
+}
+
+/* -- field list styles ----------------------------------------------------- */
+
+table.field-list td, table.field-list th {
+ border: 0 !important;
+}
+
+.field-list ul {
+ margin: 0;
+ padding-left: 1em;
+}
+
+.field-list p {
+ margin: 0;
+}
+
+.field-name {
+ -moz-hyphens: manual;
+ -ms-hyphens: manual;
+ -webkit-hyphens: manual;
+ hyphens: manual;
+}
+
+/* -- other body styles ----------------------------------------------------- */
+
+ol.arabic {
+ list-style: decimal;
+}
+
+ol.loweralpha {
+ list-style: lower-alpha;
+}
+
+ol.upperalpha {
+ list-style: upper-alpha;
+}
+
+ol.lowerroman {
+ list-style: lower-roman;
+}
+
+ol.upperroman {
+ list-style: upper-roman;
+}
+
+dl {
+ margin-bottom: 15px;
+}
+
+dd p {
+ margin-top: 0px;
+}
+
+dd ul, dd table {
+ margin-bottom: 10px;
+}
+
+dd {
+ margin-top: 3px;
+ margin-bottom: 10px;
+ margin-left: 30px;
+}
+
+dt:target, span.highlighted {
+ background-color: #fbe54e;
+}
+
+rect.highlighted {
+ fill: #fbe54e;
+}
+
+dl.glossary dt {
+ font-weight: bold;
+ font-size: 1.1em;
+}
+
+.optional {
+ font-size: 1.3em;
+}
+
+.sig-paren {
+ font-size: larger;
+}
+
+.versionmodified {
+ font-style: italic;
+}
+
+.system-message {
+ background-color: #fda;
+ padding: 5px;
+ border: 3px solid red;
+}
+
+.footnote:target {
+ background-color: #ffa;
+}
+
+.line-block {
+ display: block;
+ margin-top: 1em;
+ margin-bottom: 1em;
+}
+
+.line-block .line-block {
+ margin-top: 0;
+ margin-bottom: 0;
+ margin-left: 1.5em;
+}
+
+.guilabel, .menuselection {
+ font-family: sans-serif;
+}
+
+.accelerator {
+ text-decoration: underline;
+}
+
+.classifier {
+ font-style: oblique;
+}
+
+abbr, acronym {
+ border-bottom: dotted 1px;
+ cursor: help;
+}
+
+/* -- code displays --------------------------------------------------------- */
+
+pre {
+ overflow: auto;
+ overflow-y: hidden; /* fixes display issues on Chrome browsers */
+}
+
+span.pre {
+ -moz-hyphens: none;
+ -ms-hyphens: none;
+ -webkit-hyphens: none;
+ hyphens: none;
+}
+
+td.linenos pre {
+ padding: 5px 0px;
+ border: 0;
+ background-color: transparent;
+ color: #aaa;
+}
+
+table.highlighttable {
+ margin-left: 0.5em;
+}
+
+table.highlighttable td {
+ padding: 0 0.5em 0 0.5em;
+}
+
+div.code-block-caption {
+ padding: 2px 5px;
+ font-size: small;
+}
+
+div.code-block-caption code {
+ background-color: transparent;
+}
+
+div.code-block-caption + div > div.highlight > pre {
+ margin-top: 0;
+}
+
+div.code-block-caption span.caption-number {
+ padding: 0.1em 0.3em;
+ font-style: italic;
+}
+
+div.code-block-caption span.caption-text {
+}
+
+div.literal-block-wrapper {
+ padding: 1em 1em 0;
+}
+
+div.literal-block-wrapper div.highlight {
+ margin: 0;
+}
+
+code.descname {
+ background-color: transparent;
+ font-weight: bold;
+ font-size: 1.2em;
+}
+
+code.descclassname {
+ background-color: transparent;
+}
+
+code.xref, a code {
+ background-color: transparent;
+ font-weight: bold;
+}
+
+h1 code, h2 code, h3 code, h4 code, h5 code, h6 code {
+ background-color: transparent;
+}
+
+.viewcode-link {
+ float: right;
+}
+
+.viewcode-back {
+ float: right;
+ font-family: sans-serif;
+}
+
+div.viewcode-block:target {
+ margin: -1px -10px;
+ padding: 0 10px;
+}
+
+/* -- math display ---------------------------------------------------------- */
+
+img.math {
+ vertical-align: middle;
+}
+
+div.body div.math p {
+ text-align: center;
+}
+
+span.eqno {
+ float: right;
+}
+
+span.eqno a.headerlink {
+ position: relative;
+ left: 0px;
+ z-index: 1;
+}
+
+div.math:hover a.headerlink {
+ visibility: visible;
+}
+
+/* -- printout stylesheet --------------------------------------------------- */
+
+@media print {
+ div.document,
+ div.documentwrapper,
+ div.bodywrapper {
+ margin: 0 !important;
+ width: 100%;
+ }
+
+ div.sphinxsidebar,
+ div.related,
+ div.footer,
+ #top-link {
+ display: none;
+ }
+}
\ No newline at end of file
diff --git a/docs/_static/comment-bright.png b/docs/_static/comment-bright.png
new file mode 100644
index 0000000..15e27ed
Binary files /dev/null and b/docs/_static/comment-bright.png differ
diff --git a/docs/_static/comment-close.png b/docs/_static/comment-close.png
new file mode 100644
index 0000000..4d91bcf
Binary files /dev/null and b/docs/_static/comment-close.png differ
diff --git a/docs/_static/comment.png b/docs/_static/comment.png
new file mode 100644
index 0000000..dfbc0cb
Binary files /dev/null and b/docs/_static/comment.png differ
diff --git a/docs/_static/custom.css b/docs/_static/custom.css
new file mode 100644
index 0000000..2a924f1
--- /dev/null
+++ b/docs/_static/custom.css
@@ -0,0 +1 @@
+/* This file intentionally left blank. */
diff --git a/docs/_static/doctools.js b/docs/_static/doctools.js
new file mode 100644
index 0000000..d892892
--- /dev/null
+++ b/docs/_static/doctools.js
@@ -0,0 +1,313 @@
+/*
+ * doctools.js
+ * ~~~~~~~~~~~
+ *
+ * Sphinx JavaScript utilities for all documentation.
+ *
+ * :copyright: Copyright 2007-2018 by the Sphinx team, see AUTHORS.
+ * :license: BSD, see LICENSE for details.
+ *
+ */
+
+/**
+ * select a different prefix for underscore
+ */
+$u = _.noConflict();
+
+/**
+ * make the code below compatible with browsers without
+ * an installed firebug like debugger
+if (!window.console || !console.firebug) {
+ var names = ["log", "debug", "info", "warn", "error", "assert", "dir",
+ "dirxml", "group", "groupEnd", "time", "timeEnd", "count", "trace",
+ "profile", "profileEnd"];
+ window.console = {};
+ for (var i = 0; i < names.length; ++i)
+ window.console[names[i]] = function() {};
+}
+ */
+
+/**
+ * small helper function to urldecode strings
+ */
+jQuery.urldecode = function(x) {
+ return decodeURIComponent(x).replace(/\+/g, ' ');
+};
+
+/**
+ * small helper function to urlencode strings
+ */
+jQuery.urlencode = encodeURIComponent;
+
+/**
+ * This function returns the parsed url parameters of the
+ * current request. Multiple values per key are supported,
+ * it will always return arrays of strings for the value parts.
+ */
+jQuery.getQueryParameters = function(s) {
+ if (typeof s === 'undefined')
+ s = document.location.search;
+ var parts = s.substr(s.indexOf('?') + 1).split('&');
+ var result = {};
+ for (var i = 0; i < parts.length; i++) {
+ var tmp = parts[i].split('=', 2);
+ var key = jQuery.urldecode(tmp[0]);
+ var value = jQuery.urldecode(tmp[1]);
+ if (key in result)
+ result[key].push(value);
+ else
+ result[key] = [value];
+ }
+ return result;
+};
+
+/**
+ * highlight a given string on a jquery object by wrapping it in
+ * span elements with the given class name.
+ */
+jQuery.fn.highlightText = function(text, className) {
+ function highlight(node, addItems) {
+ if (node.nodeType === 3) {
+ var val = node.nodeValue;
+ var pos = val.toLowerCase().indexOf(text);
+ if (pos >= 0 &&
+ !jQuery(node.parentNode).hasClass(className) &&
+ !jQuery(node.parentNode).hasClass("nohighlight")) {
+ var span;
+ var isInSVG = jQuery(node).closest("body, svg, foreignObject").is("svg");
+ if (isInSVG) {
+ span = document.createElementNS("http://www.w3.org/2000/svg", "tspan");
+ } else {
+ span = document.createElement("span");
+ span.className = className;
+ }
+ span.appendChild(document.createTextNode(val.substr(pos, text.length)));
+ node.parentNode.insertBefore(span, node.parentNode.insertBefore(
+ document.createTextNode(val.substr(pos + text.length)),
+ node.nextSibling));
+ node.nodeValue = val.substr(0, pos);
+ if (isInSVG) {
+ var bbox = span.getBBox();
+ var rect = document.createElementNS("http://www.w3.org/2000/svg", "rect");
+ rect.x.baseVal.value = bbox.x;
+ rect.y.baseVal.value = bbox.y;
+ rect.width.baseVal.value = bbox.width;
+ rect.height.baseVal.value = bbox.height;
+ rect.setAttribute('class', className);
+ var parentOfText = node.parentNode.parentNode;
+ addItems.push({
+ "parent": node.parentNode,
+ "target": rect});
+ }
+ }
+ }
+ else if (!jQuery(node).is("button, select, textarea")) {
+ jQuery.each(node.childNodes, function() {
+ highlight(this, addItems);
+ });
+ }
+ }
+ var addItems = [];
+ var result = this.each(function() {
+ highlight(this, addItems);
+ });
+ for (var i = 0; i < addItems.length; ++i) {
+ jQuery(addItems[i].parent).before(addItems[i].target);
+ }
+ return result;
+};
+
+/*
+ * backward compatibility for jQuery.browser
+ * This will be supported until firefox bug is fixed.
+ */
+if (!jQuery.browser) {
+ jQuery.uaMatch = function(ua) {
+ ua = ua.toLowerCase();
+
+ var match = /(chrome)[ \/]([\w.]+)/.exec(ua) ||
+ /(webkit)[ \/]([\w.]+)/.exec(ua) ||
+ /(opera)(?:.*version|)[ \/]([\w.]+)/.exec(ua) ||
+ /(msie) ([\w.]+)/.exec(ua) ||
+ ua.indexOf("compatible") < 0 && /(mozilla)(?:.*? rv:([\w.]+)|)/.exec(ua) ||
+ [];
+
+ return {
+ browser: match[ 1 ] || "",
+ version: match[ 2 ] || "0"
+ };
+ };
+ jQuery.browser = {};
+ jQuery.browser[jQuery.uaMatch(navigator.userAgent).browser] = true;
+}
+
+/**
+ * Small JavaScript module for the documentation.
+ */
+var Documentation = {
+
+ init : function() {
+ this.fixFirefoxAnchorBug();
+ this.highlightSearchWords();
+ this.initIndexTable();
+
+ },
+
+ /**
+ * i18n support
+ */
+ TRANSLATIONS : {},
+ PLURAL_EXPR : function(n) { return n === 1 ? 0 : 1; },
+ LOCALE : 'unknown',
+
+ // gettext and ngettext don't access this so that the functions
+ // can safely bound to a different name (_ = Documentation.gettext)
+ gettext : function(string) {
+ var translated = Documentation.TRANSLATIONS[string];
+ if (typeof translated === 'undefined')
+ return string;
+ return (typeof translated === 'string') ? translated : translated[0];
+ },
+
+ ngettext : function(singular, plural, n) {
+ var translated = Documentation.TRANSLATIONS[singular];
+ if (typeof translated === 'undefined')
+ return (n == 1) ? singular : plural;
+ return translated[Documentation.PLURALEXPR(n)];
+ },
+
+ addTranslations : function(catalog) {
+ for (var key in catalog.messages)
+ this.TRANSLATIONS[key] = catalog.messages[key];
+ this.PLURAL_EXPR = new Function('n', 'return +(' + catalog.plural_expr + ')');
+ this.LOCALE = catalog.locale;
+ },
+
+ /**
+ * add context elements like header anchor links
+ */
+ addContextElements : function() {
+ $('div[id] > :header:first').each(function() {
+ $('').
+ attr('href', '#' + this.id).
+ attr('title', _('Permalink to this headline')).
+ appendTo(this);
+ });
+ $('dt[id]').each(function() {
+ $('').
+ attr('href', '#' + this.id).
+ attr('title', _('Permalink to this definition')).
+ appendTo(this);
+ });
+ },
+
+ /**
+ * workaround a firefox stupidity
+ * see: https://bugzilla.mozilla.org/show_bug.cgi?id=645075
+ */
+ fixFirefoxAnchorBug : function() {
+ if (document.location.hash && $.browser.mozilla)
+ window.setTimeout(function() {
+ document.location.href += '';
+ }, 10);
+ },
+
+ /**
+ * highlight the search words provided in the url in the text
+ */
+ highlightSearchWords : function() {
+ var params = $.getQueryParameters();
+ var terms = (params.highlight) ? params.highlight[0].split(/\s+/) : [];
+ if (terms.length) {
+ var body = $('div.body');
+ if (!body.length) {
+ body = $('body');
+ }
+ window.setTimeout(function() {
+ $.each(terms, function() {
+ body.highlightText(this.toLowerCase(), 'highlighted');
+ });
+ }, 10);
+ $('' + _('Hide Search Matches') + '
')
+ .appendTo($('#searchbox'));
+ }
+ },
+
+ /**
+ * init the domain index toggle buttons
+ */
+ initIndexTable : function() {
+ var togglers = $('img.toggler').click(function() {
+ var src = $(this).attr('src');
+ var idnum = $(this).attr('id').substr(7);
+ $('tr.cg-' + idnum).toggle();
+ if (src.substr(-9) === 'minus.png')
+ $(this).attr('src', src.substr(0, src.length-9) + 'plus.png');
+ else
+ $(this).attr('src', src.substr(0, src.length-8) + 'minus.png');
+ }).css('display', '');
+ if (DOCUMENTATION_OPTIONS.COLLAPSE_INDEX) {
+ togglers.click();
+ }
+ },
+
+ /**
+ * helper function to hide the search marks again
+ */
+ hideSearchWords : function() {
+ $('#searchbox .highlight-link').fadeOut(300);
+ $('span.highlighted').removeClass('highlighted');
+ },
+
+ /**
+ * make the url absolute
+ */
+ makeURL : function(relativeURL) {
+ return DOCUMENTATION_OPTIONS.URL_ROOT + '/' + relativeURL;
+ },
+
+ /**
+ * get the current relative url
+ */
+ getCurrentURL : function() {
+ var path = document.location.pathname;
+ var parts = path.split(/\//);
+ $.each(DOCUMENTATION_OPTIONS.URL_ROOT.split(/\//), function() {
+ if (this === '..')
+ parts.pop();
+ });
+ var url = parts.join('/');
+ return path.substring(url.lastIndexOf('/') + 1, path.length - 1);
+ },
+
+ initOnKeyListeners: function() {
+ $(document).keyup(function(event) {
+ var activeElementType = document.activeElement.tagName;
+ // don't navigate when in search box or textarea
+ if (activeElementType !== 'TEXTAREA' && activeElementType !== 'INPUT' && activeElementType !== 'SELECT') {
+ switch (event.keyCode) {
+ case 37: // left
+ var prevHref = $('link[rel="prev"]').prop('href');
+ if (prevHref) {
+ window.location.href = prevHref;
+ return false;
+ }
+ case 39: // right
+ var nextHref = $('link[rel="next"]').prop('href');
+ if (nextHref) {
+ window.location.href = nextHref;
+ return false;
+ }
+ }
+ }
+ });
+ }
+};
+
+// quick alias for translations
+_ = Documentation.gettext;
+
+$(document).ready(function() {
+ Documentation.init();
+});
\ No newline at end of file
diff --git a/docs/_static/documentation_options.js b/docs/_static/documentation_options.js
new file mode 100644
index 0000000..893cd39
--- /dev/null
+++ b/docs/_static/documentation_options.js
@@ -0,0 +1,9 @@
+var DOCUMENTATION_OPTIONS = {
+ URL_ROOT: document.getElementById("documentation_options").getAttribute('data-url_root'),
+ VERSION: '',
+ LANGUAGE: 'None',
+ COLLAPSE_INDEX: false,
+ FILE_SUFFIX: '.html',
+ HAS_SOURCE: true,
+ SOURCELINK_SUFFIX: '.txt'
+};
\ No newline at end of file
diff --git a/docs/_static/down-pressed.png b/docs/_static/down-pressed.png
new file mode 100644
index 0000000..5756c8c
Binary files /dev/null and b/docs/_static/down-pressed.png differ
diff --git a/docs/_static/down.png b/docs/_static/down.png
new file mode 100644
index 0000000..1b3bdad
Binary files /dev/null and b/docs/_static/down.png differ
diff --git a/docs/_static/file.png b/docs/_static/file.png
new file mode 100644
index 0000000..a858a41
Binary files /dev/null and b/docs/_static/file.png differ
diff --git a/docs/_static/jquery-3.2.1.js b/docs/_static/jquery-3.2.1.js
new file mode 100644
index 0000000..d2d8ca4
--- /dev/null
+++ b/docs/_static/jquery-3.2.1.js
@@ -0,0 +1,10253 @@
+/*!
+ * jQuery JavaScript Library v3.2.1
+ * https://jquery.com/
+ *
+ * Includes Sizzle.js
+ * https://sizzlejs.com/
+ *
+ * Copyright JS Foundation and other contributors
+ * Released under the MIT license
+ * https://jquery.org/license
+ *
+ * Date: 2017-03-20T18:59Z
+ */
+( function( global, factory ) {
+
+ "use strict";
+
+ if ( typeof module === "object" && typeof module.exports === "object" ) {
+
+ // For CommonJS and CommonJS-like environments where a proper `window`
+ // is present, execute the factory and get jQuery.
+ // For environments that do not have a `window` with a `document`
+ // (such as Node.js), expose a factory as module.exports.
+ // This accentuates the need for the creation of a real `window`.
+ // e.g. var jQuery = require("jquery")(window);
+ // See ticket #14549 for more info.
+ module.exports = global.document ?
+ factory( global, true ) :
+ function( w ) {
+ if ( !w.document ) {
+ throw new Error( "jQuery requires a window with a document" );
+ }
+ return factory( w );
+ };
+ } else {
+ factory( global );
+ }
+
+// Pass this if window is not defined yet
+} )( typeof window !== "undefined" ? window : this, function( window, noGlobal ) {
+
+// Edge <= 12 - 13+, Firefox <=18 - 45+, IE 10 - 11, Safari 5.1 - 9+, iOS 6 - 9.1
+// throw exceptions when non-strict code (e.g., ASP.NET 4.5) accesses strict mode
+// arguments.callee.caller (trac-13335). But as of jQuery 3.0 (2016), strict mode should be common
+// enough that all such attempts are guarded in a try block.
+"use strict";
+
+var arr = [];
+
+var document = window.document;
+
+var getProto = Object.getPrototypeOf;
+
+var slice = arr.slice;
+
+var concat = arr.concat;
+
+var push = arr.push;
+
+var indexOf = arr.indexOf;
+
+var class2type = {};
+
+var toString = class2type.toString;
+
+var hasOwn = class2type.hasOwnProperty;
+
+var fnToString = hasOwn.toString;
+
+var ObjectFunctionString = fnToString.call( Object );
+
+var support = {};
+
+
+
+ function DOMEval( code, doc ) {
+ doc = doc || document;
+
+ var script = doc.createElement( "script" );
+
+ script.text = code;
+ doc.head.appendChild( script ).parentNode.removeChild( script );
+ }
+/* global Symbol */
+// Defining this global in .eslintrc.json would create a danger of using the global
+// unguarded in another place, it seems safer to define global only for this module
+
+
+
+var
+ version = "3.2.1",
+
+ // Define a local copy of jQuery
+ jQuery = function( selector, context ) {
+
+ // The jQuery object is actually just the init constructor 'enhanced'
+ // Need init if jQuery is called (just allow error to be thrown if not included)
+ return new jQuery.fn.init( selector, context );
+ },
+
+ // Support: Android <=4.0 only
+ // Make sure we trim BOM and NBSP
+ rtrim = /^[\s\uFEFF\xA0]+|[\s\uFEFF\xA0]+$/g,
+
+ // Matches dashed string for camelizing
+ rmsPrefix = /^-ms-/,
+ rdashAlpha = /-([a-z])/g,
+
+ // Used by jQuery.camelCase as callback to replace()
+ fcamelCase = function( all, letter ) {
+ return letter.toUpperCase();
+ };
+
+jQuery.fn = jQuery.prototype = {
+
+ // The current version of jQuery being used
+ jquery: version,
+
+ constructor: jQuery,
+
+ // The default length of a jQuery object is 0
+ length: 0,
+
+ toArray: function() {
+ return slice.call( this );
+ },
+
+ // Get the Nth element in the matched element set OR
+ // Get the whole matched element set as a clean array
+ get: function( num ) {
+
+ // Return all the elements in a clean array
+ if ( num == null ) {
+ return slice.call( this );
+ }
+
+ // Return just the one element from the set
+ return num < 0 ? this[ num + this.length ] : this[ num ];
+ },
+
+ // Take an array of elements and push it onto the stack
+ // (returning the new matched element set)
+ pushStack: function( elems ) {
+
+ // Build a new jQuery matched element set
+ var ret = jQuery.merge( this.constructor(), elems );
+
+ // Add the old object onto the stack (as a reference)
+ ret.prevObject = this;
+
+ // Return the newly-formed element set
+ return ret;
+ },
+
+ // Execute a callback for every element in the matched set.
+ each: function( callback ) {
+ return jQuery.each( this, callback );
+ },
+
+ map: function( callback ) {
+ return this.pushStack( jQuery.map( this, function( elem, i ) {
+ return callback.call( elem, i, elem );
+ } ) );
+ },
+
+ slice: function() {
+ return this.pushStack( slice.apply( this, arguments ) );
+ },
+
+ first: function() {
+ return this.eq( 0 );
+ },
+
+ last: function() {
+ return this.eq( -1 );
+ },
+
+ eq: function( i ) {
+ var len = this.length,
+ j = +i + ( i < 0 ? len : 0 );
+ return this.pushStack( j >= 0 && j < len ? [ this[ j ] ] : [] );
+ },
+
+ end: function() {
+ return this.prevObject || this.constructor();
+ },
+
+ // For internal use only.
+ // Behaves like an Array's method, not like a jQuery method.
+ push: push,
+ sort: arr.sort,
+ splice: arr.splice
+};
+
+jQuery.extend = jQuery.fn.extend = function() {
+ var options, name, src, copy, copyIsArray, clone,
+ target = arguments[ 0 ] || {},
+ i = 1,
+ length = arguments.length,
+ deep = false;
+
+ // Handle a deep copy situation
+ if ( typeof target === "boolean" ) {
+ deep = target;
+
+ // Skip the boolean and the target
+ target = arguments[ i ] || {};
+ i++;
+ }
+
+ // Handle case when target is a string or something (possible in deep copy)
+ if ( typeof target !== "object" && !jQuery.isFunction( target ) ) {
+ target = {};
+ }
+
+ // Extend jQuery itself if only one argument is passed
+ if ( i === length ) {
+ target = this;
+ i--;
+ }
+
+ for ( ; i < length; i++ ) {
+
+ // Only deal with non-null/undefined values
+ if ( ( options = arguments[ i ] ) != null ) {
+
+ // Extend the base object
+ for ( name in options ) {
+ src = target[ name ];
+ copy = options[ name ];
+
+ // Prevent never-ending loop
+ if ( target === copy ) {
+ continue;
+ }
+
+ // Recurse if we're merging plain objects or arrays
+ if ( deep && copy && ( jQuery.isPlainObject( copy ) ||
+ ( copyIsArray = Array.isArray( copy ) ) ) ) {
+
+ if ( copyIsArray ) {
+ copyIsArray = false;
+ clone = src && Array.isArray( src ) ? src : [];
+
+ } else {
+ clone = src && jQuery.isPlainObject( src ) ? src : {};
+ }
+
+ // Never move original objects, clone them
+ target[ name ] = jQuery.extend( deep, clone, copy );
+
+ // Don't bring in undefined values
+ } else if ( copy !== undefined ) {
+ target[ name ] = copy;
+ }
+ }
+ }
+ }
+
+ // Return the modified object
+ return target;
+};
+
+jQuery.extend( {
+
+ // Unique for each copy of jQuery on the page
+ expando: "jQuery" + ( version + Math.random() ).replace( /\D/g, "" ),
+
+ // Assume jQuery is ready without the ready module
+ isReady: true,
+
+ error: function( msg ) {
+ throw new Error( msg );
+ },
+
+ noop: function() {},
+
+ isFunction: function( obj ) {
+ return jQuery.type( obj ) === "function";
+ },
+
+ isWindow: function( obj ) {
+ return obj != null && obj === obj.window;
+ },
+
+ isNumeric: function( obj ) {
+
+ // As of jQuery 3.0, isNumeric is limited to
+ // strings and numbers (primitives or objects)
+ // that can be coerced to finite numbers (gh-2662)
+ var type = jQuery.type( obj );
+ return ( type === "number" || type === "string" ) &&
+
+ // parseFloat NaNs numeric-cast false positives ("")
+ // ...but misinterprets leading-number strings, particularly hex literals ("0x...")
+ // subtraction forces infinities to NaN
+ !isNaN( obj - parseFloat( obj ) );
+ },
+
+ isPlainObject: function( obj ) {
+ var proto, Ctor;
+
+ // Detect obvious negatives
+ // Use toString instead of jQuery.type to catch host objects
+ if ( !obj || toString.call( obj ) !== "[object Object]" ) {
+ return false;
+ }
+
+ proto = getProto( obj );
+
+ // Objects with no prototype (e.g., `Object.create( null )`) are plain
+ if ( !proto ) {
+ return true;
+ }
+
+ // Objects with prototype are plain iff they were constructed by a global Object function
+ Ctor = hasOwn.call( proto, "constructor" ) && proto.constructor;
+ return typeof Ctor === "function" && fnToString.call( Ctor ) === ObjectFunctionString;
+ },
+
+ isEmptyObject: function( obj ) {
+
+ /* eslint-disable no-unused-vars */
+ // See https://github.com/eslint/eslint/issues/6125
+ var name;
+
+ for ( name in obj ) {
+ return false;
+ }
+ return true;
+ },
+
+ type: function( obj ) {
+ if ( obj == null ) {
+ return obj + "";
+ }
+
+ // Support: Android <=2.3 only (functionish RegExp)
+ return typeof obj === "object" || typeof obj === "function" ?
+ class2type[ toString.call( obj ) ] || "object" :
+ typeof obj;
+ },
+
+ // Evaluates a script in a global context
+ globalEval: function( code ) {
+ DOMEval( code );
+ },
+
+ // Convert dashed to camelCase; used by the css and data modules
+ // Support: IE <=9 - 11, Edge 12 - 13
+ // Microsoft forgot to hump their vendor prefix (#9572)
+ camelCase: function( string ) {
+ return string.replace( rmsPrefix, "ms-" ).replace( rdashAlpha, fcamelCase );
+ },
+
+ each: function( obj, callback ) {
+ var length, i = 0;
+
+ if ( isArrayLike( obj ) ) {
+ length = obj.length;
+ for ( ; i < length; i++ ) {
+ if ( callback.call( obj[ i ], i, obj[ i ] ) === false ) {
+ break;
+ }
+ }
+ } else {
+ for ( i in obj ) {
+ if ( callback.call( obj[ i ], i, obj[ i ] ) === false ) {
+ break;
+ }
+ }
+ }
+
+ return obj;
+ },
+
+ // Support: Android <=4.0 only
+ trim: function( text ) {
+ return text == null ?
+ "" :
+ ( text + "" ).replace( rtrim, "" );
+ },
+
+ // results is for internal usage only
+ makeArray: function( arr, results ) {
+ var ret = results || [];
+
+ if ( arr != null ) {
+ if ( isArrayLike( Object( arr ) ) ) {
+ jQuery.merge( ret,
+ typeof arr === "string" ?
+ [ arr ] : arr
+ );
+ } else {
+ push.call( ret, arr );
+ }
+ }
+
+ return ret;
+ },
+
+ inArray: function( elem, arr, i ) {
+ return arr == null ? -1 : indexOf.call( arr, elem, i );
+ },
+
+ // Support: Android <=4.0 only, PhantomJS 1 only
+ // push.apply(_, arraylike) throws on ancient WebKit
+ merge: function( first, second ) {
+ var len = +second.length,
+ j = 0,
+ i = first.length;
+
+ for ( ; j < len; j++ ) {
+ first[ i++ ] = second[ j ];
+ }
+
+ first.length = i;
+
+ return first;
+ },
+
+ grep: function( elems, callback, invert ) {
+ var callbackInverse,
+ matches = [],
+ i = 0,
+ length = elems.length,
+ callbackExpect = !invert;
+
+ // Go through the array, only saving the items
+ // that pass the validator function
+ for ( ; i < length; i++ ) {
+ callbackInverse = !callback( elems[ i ], i );
+ if ( callbackInverse !== callbackExpect ) {
+ matches.push( elems[ i ] );
+ }
+ }
+
+ return matches;
+ },
+
+ // arg is for internal usage only
+ map: function( elems, callback, arg ) {
+ var length, value,
+ i = 0,
+ ret = [];
+
+ // Go through the array, translating each of the items to their new values
+ if ( isArrayLike( elems ) ) {
+ length = elems.length;
+ for ( ; i < length; i++ ) {
+ value = callback( elems[ i ], i, arg );
+
+ if ( value != null ) {
+ ret.push( value );
+ }
+ }
+
+ // Go through every key on the object,
+ } else {
+ for ( i in elems ) {
+ value = callback( elems[ i ], i, arg );
+
+ if ( value != null ) {
+ ret.push( value );
+ }
+ }
+ }
+
+ // Flatten any nested arrays
+ return concat.apply( [], ret );
+ },
+
+ // A global GUID counter for objects
+ guid: 1,
+
+ // Bind a function to a context, optionally partially applying any
+ // arguments.
+ proxy: function( fn, context ) {
+ var tmp, args, proxy;
+
+ if ( typeof context === "string" ) {
+ tmp = fn[ context ];
+ context = fn;
+ fn = tmp;
+ }
+
+ // Quick check to determine if target is callable, in the spec
+ // this throws a TypeError, but we will just return undefined.
+ if ( !jQuery.isFunction( fn ) ) {
+ return undefined;
+ }
+
+ // Simulated bind
+ args = slice.call( arguments, 2 );
+ proxy = function() {
+ return fn.apply( context || this, args.concat( slice.call( arguments ) ) );
+ };
+
+ // Set the guid of unique handler to the same of original handler, so it can be removed
+ proxy.guid = fn.guid = fn.guid || jQuery.guid++;
+
+ return proxy;
+ },
+
+ now: Date.now,
+
+ // jQuery.support is not used in Core but other projects attach their
+ // properties to it so it needs to exist.
+ support: support
+} );
+
+if ( typeof Symbol === "function" ) {
+ jQuery.fn[ Symbol.iterator ] = arr[ Symbol.iterator ];
+}
+
+// Populate the class2type map
+jQuery.each( "Boolean Number String Function Array Date RegExp Object Error Symbol".split( " " ),
+function( i, name ) {
+ class2type[ "[object " + name + "]" ] = name.toLowerCase();
+} );
+
+function isArrayLike( obj ) {
+
+ // Support: real iOS 8.2 only (not reproducible in simulator)
+ // `in` check used to prevent JIT error (gh-2145)
+ // hasOwn isn't used here due to false negatives
+ // regarding Nodelist length in IE
+ var length = !!obj && "length" in obj && obj.length,
+ type = jQuery.type( obj );
+
+ if ( type === "function" || jQuery.isWindow( obj ) ) {
+ return false;
+ }
+
+ return type === "array" || length === 0 ||
+ typeof length === "number" && length > 0 && ( length - 1 ) in obj;
+}
+var Sizzle =
+/*!
+ * Sizzle CSS Selector Engine v2.3.3
+ * https://sizzlejs.com/
+ *
+ * Copyright jQuery Foundation and other contributors
+ * Released under the MIT license
+ * http://jquery.org/license
+ *
+ * Date: 2016-08-08
+ */
+(function( window ) {
+
+var i,
+ support,
+ Expr,
+ getText,
+ isXML,
+ tokenize,
+ compile,
+ select,
+ outermostContext,
+ sortInput,
+ hasDuplicate,
+
+ // Local document vars
+ setDocument,
+ document,
+ docElem,
+ documentIsHTML,
+ rbuggyQSA,
+ rbuggyMatches,
+ matches,
+ contains,
+
+ // Instance-specific data
+ expando = "sizzle" + 1 * new Date(),
+ preferredDoc = window.document,
+ dirruns = 0,
+ done = 0,
+ classCache = createCache(),
+ tokenCache = createCache(),
+ compilerCache = createCache(),
+ sortOrder = function( a, b ) {
+ if ( a === b ) {
+ hasDuplicate = true;
+ }
+ return 0;
+ },
+
+ // Instance methods
+ hasOwn = ({}).hasOwnProperty,
+ arr = [],
+ pop = arr.pop,
+ push_native = arr.push,
+ push = arr.push,
+ slice = arr.slice,
+ // Use a stripped-down indexOf as it's faster than native
+ // https://jsperf.com/thor-indexof-vs-for/5
+ indexOf = function( list, elem ) {
+ var i = 0,
+ len = list.length;
+ for ( ; i < len; i++ ) {
+ if ( list[i] === elem ) {
+ return i;
+ }
+ }
+ return -1;
+ },
+
+ booleans = "checked|selected|async|autofocus|autoplay|controls|defer|disabled|hidden|ismap|loop|multiple|open|readonly|required|scoped",
+
+ // Regular expressions
+
+ // http://www.w3.org/TR/css3-selectors/#whitespace
+ whitespace = "[\\x20\\t\\r\\n\\f]",
+
+ // http://www.w3.org/TR/CSS21/syndata.html#value-def-identifier
+ identifier = "(?:\\\\.|[\\w-]|[^\0-\\xa0])+",
+
+ // Attribute selectors: http://www.w3.org/TR/selectors/#attribute-selectors
+ attributes = "\\[" + whitespace + "*(" + identifier + ")(?:" + whitespace +
+ // Operator (capture 2)
+ "*([*^$|!~]?=)" + whitespace +
+ // "Attribute values must be CSS identifiers [capture 5] or strings [capture 3 or capture 4]"
+ "*(?:'((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\"|(" + identifier + "))|)" + whitespace +
+ "*\\]",
+
+ pseudos = ":(" + identifier + ")(?:\\((" +
+ // To reduce the number of selectors needing tokenize in the preFilter, prefer arguments:
+ // 1. quoted (capture 3; capture 4 or capture 5)
+ "('((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\")|" +
+ // 2. simple (capture 6)
+ "((?:\\\\.|[^\\\\()[\\]]|" + attributes + ")*)|" +
+ // 3. anything else (capture 2)
+ ".*" +
+ ")\\)|)",
+
+ // Leading and non-escaped trailing whitespace, capturing some non-whitespace characters preceding the latter
+ rwhitespace = new RegExp( whitespace + "+", "g" ),
+ rtrim = new RegExp( "^" + whitespace + "+|((?:^|[^\\\\])(?:\\\\.)*)" + whitespace + "+$", "g" ),
+
+ rcomma = new RegExp( "^" + whitespace + "*," + whitespace + "*" ),
+ rcombinators = new RegExp( "^" + whitespace + "*([>+~]|" + whitespace + ")" + whitespace + "*" ),
+
+ rattributeQuotes = new RegExp( "=" + whitespace + "*([^\\]'\"]*?)" + whitespace + "*\\]", "g" ),
+
+ rpseudo = new RegExp( pseudos ),
+ ridentifier = new RegExp( "^" + identifier + "$" ),
+
+ matchExpr = {
+ "ID": new RegExp( "^#(" + identifier + ")" ),
+ "CLASS": new RegExp( "^\\.(" + identifier + ")" ),
+ "TAG": new RegExp( "^(" + identifier + "|[*])" ),
+ "ATTR": new RegExp( "^" + attributes ),
+ "PSEUDO": new RegExp( "^" + pseudos ),
+ "CHILD": new RegExp( "^:(only|first|last|nth|nth-last)-(child|of-type)(?:\\(" + whitespace +
+ "*(even|odd|(([+-]|)(\\d*)n|)" + whitespace + "*(?:([+-]|)" + whitespace +
+ "*(\\d+)|))" + whitespace + "*\\)|)", "i" ),
+ "bool": new RegExp( "^(?:" + booleans + ")$", "i" ),
+ // For use in libraries implementing .is()
+ // We use this for POS matching in `select`
+ "needsContext": new RegExp( "^" + whitespace + "*[>+~]|:(even|odd|eq|gt|lt|nth|first|last)(?:\\(" +
+ whitespace + "*((?:-\\d)?\\d*)" + whitespace + "*\\)|)(?=[^-]|$)", "i" )
+ },
+
+ rinputs = /^(?:input|select|textarea|button)$/i,
+ rheader = /^h\d$/i,
+
+ rnative = /^[^{]+\{\s*\[native \w/,
+
+ // Easily-parseable/retrievable ID or TAG or CLASS selectors
+ rquickExpr = /^(?:#([\w-]+)|(\w+)|\.([\w-]+))$/,
+
+ rsibling = /[+~]/,
+
+ // CSS escapes
+ // http://www.w3.org/TR/CSS21/syndata.html#escaped-characters
+ runescape = new RegExp( "\\\\([\\da-f]{1,6}" + whitespace + "?|(" + whitespace + ")|.)", "ig" ),
+ funescape = function( _, escaped, escapedWhitespace ) {
+ var high = "0x" + escaped - 0x10000;
+ // NaN means non-codepoint
+ // Support: Firefox<24
+ // Workaround erroneous numeric interpretation of +"0x"
+ return high !== high || escapedWhitespace ?
+ escaped :
+ high < 0 ?
+ // BMP codepoint
+ String.fromCharCode( high + 0x10000 ) :
+ // Supplemental Plane codepoint (surrogate pair)
+ String.fromCharCode( high >> 10 | 0xD800, high & 0x3FF | 0xDC00 );
+ },
+
+ // CSS string/identifier serialization
+ // https://drafts.csswg.org/cssom/#common-serializing-idioms
+ rcssescape = /([\0-\x1f\x7f]|^-?\d)|^-$|[^\0-\x1f\x7f-\uFFFF\w-]/g,
+ fcssescape = function( ch, asCodePoint ) {
+ if ( asCodePoint ) {
+
+ // U+0000 NULL becomes U+FFFD REPLACEMENT CHARACTER
+ if ( ch === "\0" ) {
+ return "\uFFFD";
+ }
+
+ // Control characters and (dependent upon position) numbers get escaped as code points
+ return ch.slice( 0, -1 ) + "\\" + ch.charCodeAt( ch.length - 1 ).toString( 16 ) + " ";
+ }
+
+ // Other potentially-special ASCII characters get backslash-escaped
+ return "\\" + ch;
+ },
+
+ // Used for iframes
+ // See setDocument()
+ // Removing the function wrapper causes a "Permission Denied"
+ // error in IE
+ unloadHandler = function() {
+ setDocument();
+ },
+
+ disabledAncestor = addCombinator(
+ function( elem ) {
+ return elem.disabled === true && ("form" in elem || "label" in elem);
+ },
+ { dir: "parentNode", next: "legend" }
+ );
+
+// Optimize for push.apply( _, NodeList )
+try {
+ push.apply(
+ (arr = slice.call( preferredDoc.childNodes )),
+ preferredDoc.childNodes
+ );
+ // Support: Android<4.0
+ // Detect silently failing push.apply
+ arr[ preferredDoc.childNodes.length ].nodeType;
+} catch ( e ) {
+ push = { apply: arr.length ?
+
+ // Leverage slice if possible
+ function( target, els ) {
+ push_native.apply( target, slice.call(els) );
+ } :
+
+ // Support: IE<9
+ // Otherwise append directly
+ function( target, els ) {
+ var j = target.length,
+ i = 0;
+ // Can't trust NodeList.length
+ while ( (target[j++] = els[i++]) ) {}
+ target.length = j - 1;
+ }
+ };
+}
+
+function Sizzle( selector, context, results, seed ) {
+ var m, i, elem, nid, match, groups, newSelector,
+ newContext = context && context.ownerDocument,
+
+ // nodeType defaults to 9, since context defaults to document
+ nodeType = context ? context.nodeType : 9;
+
+ results = results || [];
+
+ // Return early from calls with invalid selector or context
+ if ( typeof selector !== "string" || !selector ||
+ nodeType !== 1 && nodeType !== 9 && nodeType !== 11 ) {
+
+ return results;
+ }
+
+ // Try to shortcut find operations (as opposed to filters) in HTML documents
+ if ( !seed ) {
+
+ if ( ( context ? context.ownerDocument || context : preferredDoc ) !== document ) {
+ setDocument( context );
+ }
+ context = context || document;
+
+ if ( documentIsHTML ) {
+
+ // If the selector is sufficiently simple, try using a "get*By*" DOM method
+ // (excepting DocumentFragment context, where the methods don't exist)
+ if ( nodeType !== 11 && (match = rquickExpr.exec( selector )) ) {
+
+ // ID selector
+ if ( (m = match[1]) ) {
+
+ // Document context
+ if ( nodeType === 9 ) {
+ if ( (elem = context.getElementById( m )) ) {
+
+ // Support: IE, Opera, Webkit
+ // TODO: identify versions
+ // getElementById can match elements by name instead of ID
+ if ( elem.id === m ) {
+ results.push( elem );
+ return results;
+ }
+ } else {
+ return results;
+ }
+
+ // Element context
+ } else {
+
+ // Support: IE, Opera, Webkit
+ // TODO: identify versions
+ // getElementById can match elements by name instead of ID
+ if ( newContext && (elem = newContext.getElementById( m )) &&
+ contains( context, elem ) &&
+ elem.id === m ) {
+
+ results.push( elem );
+ return results;
+ }
+ }
+
+ // Type selector
+ } else if ( match[2] ) {
+ push.apply( results, context.getElementsByTagName( selector ) );
+ return results;
+
+ // Class selector
+ } else if ( (m = match[3]) && support.getElementsByClassName &&
+ context.getElementsByClassName ) {
+
+ push.apply( results, context.getElementsByClassName( m ) );
+ return results;
+ }
+ }
+
+ // Take advantage of querySelectorAll
+ if ( support.qsa &&
+ !compilerCache[ selector + " " ] &&
+ (!rbuggyQSA || !rbuggyQSA.test( selector )) ) {
+
+ if ( nodeType !== 1 ) {
+ newContext = context;
+ newSelector = selector;
+
+ // qSA looks outside Element context, which is not what we want
+ // Thanks to Andrew Dupont for this workaround technique
+ // Support: IE <=8
+ // Exclude object elements
+ } else if ( context.nodeName.toLowerCase() !== "object" ) {
+
+ // Capture the context ID, setting it first if necessary
+ if ( (nid = context.getAttribute( "id" )) ) {
+ nid = nid.replace( rcssescape, fcssescape );
+ } else {
+ context.setAttribute( "id", (nid = expando) );
+ }
+
+ // Prefix every selector in the list
+ groups = tokenize( selector );
+ i = groups.length;
+ while ( i-- ) {
+ groups[i] = "#" + nid + " " + toSelector( groups[i] );
+ }
+ newSelector = groups.join( "," );
+
+ // Expand context for sibling selectors
+ newContext = rsibling.test( selector ) && testContext( context.parentNode ) ||
+ context;
+ }
+
+ if ( newSelector ) {
+ try {
+ push.apply( results,
+ newContext.querySelectorAll( newSelector )
+ );
+ return results;
+ } catch ( qsaError ) {
+ } finally {
+ if ( nid === expando ) {
+ context.removeAttribute( "id" );
+ }
+ }
+ }
+ }
+ }
+ }
+
+ // All others
+ return select( selector.replace( rtrim, "$1" ), context, results, seed );
+}
+
+/**
+ * Create key-value caches of limited size
+ * @returns {function(string, object)} Returns the Object data after storing it on itself with
+ * property name the (space-suffixed) string and (if the cache is larger than Expr.cacheLength)
+ * deleting the oldest entry
+ */
+function createCache() {
+ var keys = [];
+
+ function cache( key, value ) {
+ // Use (key + " ") to avoid collision with native prototype properties (see Issue #157)
+ if ( keys.push( key + " " ) > Expr.cacheLength ) {
+ // Only keep the most recent entries
+ delete cache[ keys.shift() ];
+ }
+ return (cache[ key + " " ] = value);
+ }
+ return cache;
+}
+
+/**
+ * Mark a function for special use by Sizzle
+ * @param {Function} fn The function to mark
+ */
+function markFunction( fn ) {
+ fn[ expando ] = true;
+ return fn;
+}
+
+/**
+ * Support testing using an element
+ * @param {Function} fn Passed the created element and returns a boolean result
+ */
+function assert( fn ) {
+ var el = document.createElement("fieldset");
+
+ try {
+ return !!fn( el );
+ } catch (e) {
+ return false;
+ } finally {
+ // Remove from its parent by default
+ if ( el.parentNode ) {
+ el.parentNode.removeChild( el );
+ }
+ // release memory in IE
+ el = null;
+ }
+}
+
+/**
+ * Adds the same handler for all of the specified attrs
+ * @param {String} attrs Pipe-separated list of attributes
+ * @param {Function} handler The method that will be applied
+ */
+function addHandle( attrs, handler ) {
+ var arr = attrs.split("|"),
+ i = arr.length;
+
+ while ( i-- ) {
+ Expr.attrHandle[ arr[i] ] = handler;
+ }
+}
+
+/**
+ * Checks document order of two siblings
+ * @param {Element} a
+ * @param {Element} b
+ * @returns {Number} Returns less than 0 if a precedes b, greater than 0 if a follows b
+ */
+function siblingCheck( a, b ) {
+ var cur = b && a,
+ diff = cur && a.nodeType === 1 && b.nodeType === 1 &&
+ a.sourceIndex - b.sourceIndex;
+
+ // Use IE sourceIndex if available on both nodes
+ if ( diff ) {
+ return diff;
+ }
+
+ // Check if b follows a
+ if ( cur ) {
+ while ( (cur = cur.nextSibling) ) {
+ if ( cur === b ) {
+ return -1;
+ }
+ }
+ }
+
+ return a ? 1 : -1;
+}
+
+/**
+ * Returns a function to use in pseudos for input types
+ * @param {String} type
+ */
+function createInputPseudo( type ) {
+ return function( elem ) {
+ var name = elem.nodeName.toLowerCase();
+ return name === "input" && elem.type === type;
+ };
+}
+
+/**
+ * Returns a function to use in pseudos for buttons
+ * @param {String} type
+ */
+function createButtonPseudo( type ) {
+ return function( elem ) {
+ var name = elem.nodeName.toLowerCase();
+ return (name === "input" || name === "button") && elem.type === type;
+ };
+}
+
+/**
+ * Returns a function to use in pseudos for :enabled/:disabled
+ * @param {Boolean} disabled true for :disabled; false for :enabled
+ */
+function createDisabledPseudo( disabled ) {
+
+ // Known :disabled false positives: fieldset[disabled] > legend:nth-of-type(n+2) :can-disable
+ return function( elem ) {
+
+ // Only certain elements can match :enabled or :disabled
+ // https://html.spec.whatwg.org/multipage/scripting.html#selector-enabled
+ // https://html.spec.whatwg.org/multipage/scripting.html#selector-disabled
+ if ( "form" in elem ) {
+
+ // Check for inherited disabledness on relevant non-disabled elements:
+ // * listed form-associated elements in a disabled fieldset
+ // https://html.spec.whatwg.org/multipage/forms.html#category-listed
+ // https://html.spec.whatwg.org/multipage/forms.html#concept-fe-disabled
+ // * option elements in a disabled optgroup
+ // https://html.spec.whatwg.org/multipage/forms.html#concept-option-disabled
+ // All such elements have a "form" property.
+ if ( elem.parentNode && elem.disabled === false ) {
+
+ // Option elements defer to a parent optgroup if present
+ if ( "label" in elem ) {
+ if ( "label" in elem.parentNode ) {
+ return elem.parentNode.disabled === disabled;
+ } else {
+ return elem.disabled === disabled;
+ }
+ }
+
+ // Support: IE 6 - 11
+ // Use the isDisabled shortcut property to check for disabled fieldset ancestors
+ return elem.isDisabled === disabled ||
+
+ // Where there is no isDisabled, check manually
+ /* jshint -W018 */
+ elem.isDisabled !== !disabled &&
+ disabledAncestor( elem ) === disabled;
+ }
+
+ return elem.disabled === disabled;
+
+ // Try to winnow out elements that can't be disabled before trusting the disabled property.
+ // Some victims get caught in our net (label, legend, menu, track), but it shouldn't
+ // even exist on them, let alone have a boolean value.
+ } else if ( "label" in elem ) {
+ return elem.disabled === disabled;
+ }
+
+ // Remaining elements are neither :enabled nor :disabled
+ return false;
+ };
+}
+
+/**
+ * Returns a function to use in pseudos for positionals
+ * @param {Function} fn
+ */
+function createPositionalPseudo( fn ) {
+ return markFunction(function( argument ) {
+ argument = +argument;
+ return markFunction(function( seed, matches ) {
+ var j,
+ matchIndexes = fn( [], seed.length, argument ),
+ i = matchIndexes.length;
+
+ // Match elements found at the specified indexes
+ while ( i-- ) {
+ if ( seed[ (j = matchIndexes[i]) ] ) {
+ seed[j] = !(matches[j] = seed[j]);
+ }
+ }
+ });
+ });
+}
+
+/**
+ * Checks a node for validity as a Sizzle context
+ * @param {Element|Object=} context
+ * @returns {Element|Object|Boolean} The input node if acceptable, otherwise a falsy value
+ */
+function testContext( context ) {
+ return context && typeof context.getElementsByTagName !== "undefined" && context;
+}
+
+// Expose support vars for convenience
+support = Sizzle.support = {};
+
+/**
+ * Detects XML nodes
+ * @param {Element|Object} elem An element or a document
+ * @returns {Boolean} True iff elem is a non-HTML XML node
+ */
+isXML = Sizzle.isXML = function( elem ) {
+ // documentElement is verified for cases where it doesn't yet exist
+ // (such as loading iframes in IE - #4833)
+ var documentElement = elem && (elem.ownerDocument || elem).documentElement;
+ return documentElement ? documentElement.nodeName !== "HTML" : false;
+};
+
+/**
+ * Sets document-related variables once based on the current document
+ * @param {Element|Object} [doc] An element or document object to use to set the document
+ * @returns {Object} Returns the current document
+ */
+setDocument = Sizzle.setDocument = function( node ) {
+ var hasCompare, subWindow,
+ doc = node ? node.ownerDocument || node : preferredDoc;
+
+ // Return early if doc is invalid or already selected
+ if ( doc === document || doc.nodeType !== 9 || !doc.documentElement ) {
+ return document;
+ }
+
+ // Update global variables
+ document = doc;
+ docElem = document.documentElement;
+ documentIsHTML = !isXML( document );
+
+ // Support: IE 9-11, Edge
+ // Accessing iframe documents after unload throws "permission denied" errors (jQuery #13936)
+ if ( preferredDoc !== document &&
+ (subWindow = document.defaultView) && subWindow.top !== subWindow ) {
+
+ // Support: IE 11, Edge
+ if ( subWindow.addEventListener ) {
+ subWindow.addEventListener( "unload", unloadHandler, false );
+
+ // Support: IE 9 - 10 only
+ } else if ( subWindow.attachEvent ) {
+ subWindow.attachEvent( "onunload", unloadHandler );
+ }
+ }
+
+ /* Attributes
+ ---------------------------------------------------------------------- */
+
+ // Support: IE<8
+ // Verify that getAttribute really returns attributes and not properties
+ // (excepting IE8 booleans)
+ support.attributes = assert(function( el ) {
+ el.className = "i";
+ return !el.getAttribute("className");
+ });
+
+ /* getElement(s)By*
+ ---------------------------------------------------------------------- */
+
+ // Check if getElementsByTagName("*") returns only elements
+ support.getElementsByTagName = assert(function( el ) {
+ el.appendChild( document.createComment("") );
+ return !el.getElementsByTagName("*").length;
+ });
+
+ // Support: IE<9
+ support.getElementsByClassName = rnative.test( document.getElementsByClassName );
+
+ // Support: IE<10
+ // Check if getElementById returns elements by name
+ // The broken getElementById methods don't pick up programmatically-set names,
+ // so use a roundabout getElementsByName test
+ support.getById = assert(function( el ) {
+ docElem.appendChild( el ).id = expando;
+ return !document.getElementsByName || !document.getElementsByName( expando ).length;
+ });
+
+ // ID filter and find
+ if ( support.getById ) {
+ Expr.filter["ID"] = function( id ) {
+ var attrId = id.replace( runescape, funescape );
+ return function( elem ) {
+ return elem.getAttribute("id") === attrId;
+ };
+ };
+ Expr.find["ID"] = function( id, context ) {
+ if ( typeof context.getElementById !== "undefined" && documentIsHTML ) {
+ var elem = context.getElementById( id );
+ return elem ? [ elem ] : [];
+ }
+ };
+ } else {
+ Expr.filter["ID"] = function( id ) {
+ var attrId = id.replace( runescape, funescape );
+ return function( elem ) {
+ var node = typeof elem.getAttributeNode !== "undefined" &&
+ elem.getAttributeNode("id");
+ return node && node.value === attrId;
+ };
+ };
+
+ // Support: IE 6 - 7 only
+ // getElementById is not reliable as a find shortcut
+ Expr.find["ID"] = function( id, context ) {
+ if ( typeof context.getElementById !== "undefined" && documentIsHTML ) {
+ var node, i, elems,
+ elem = context.getElementById( id );
+
+ if ( elem ) {
+
+ // Verify the id attribute
+ node = elem.getAttributeNode("id");
+ if ( node && node.value === id ) {
+ return [ elem ];
+ }
+
+ // Fall back on getElementsByName
+ elems = context.getElementsByName( id );
+ i = 0;
+ while ( (elem = elems[i++]) ) {
+ node = elem.getAttributeNode("id");
+ if ( node && node.value === id ) {
+ return [ elem ];
+ }
+ }
+ }
+
+ return [];
+ }
+ };
+ }
+
+ // Tag
+ Expr.find["TAG"] = support.getElementsByTagName ?
+ function( tag, context ) {
+ if ( typeof context.getElementsByTagName !== "undefined" ) {
+ return context.getElementsByTagName( tag );
+
+ // DocumentFragment nodes don't have gEBTN
+ } else if ( support.qsa ) {
+ return context.querySelectorAll( tag );
+ }
+ } :
+
+ function( tag, context ) {
+ var elem,
+ tmp = [],
+ i = 0,
+ // By happy coincidence, a (broken) gEBTN appears on DocumentFragment nodes too
+ results = context.getElementsByTagName( tag );
+
+ // Filter out possible comments
+ if ( tag === "*" ) {
+ while ( (elem = results[i++]) ) {
+ if ( elem.nodeType === 1 ) {
+ tmp.push( elem );
+ }
+ }
+
+ return tmp;
+ }
+ return results;
+ };
+
+ // Class
+ Expr.find["CLASS"] = support.getElementsByClassName && function( className, context ) {
+ if ( typeof context.getElementsByClassName !== "undefined" && documentIsHTML ) {
+ return context.getElementsByClassName( className );
+ }
+ };
+
+ /* QSA/matchesSelector
+ ---------------------------------------------------------------------- */
+
+ // QSA and matchesSelector support
+
+ // matchesSelector(:active) reports false when true (IE9/Opera 11.5)
+ rbuggyMatches = [];
+
+ // qSa(:focus) reports false when true (Chrome 21)
+ // We allow this because of a bug in IE8/9 that throws an error
+ // whenever `document.activeElement` is accessed on an iframe
+ // So, we allow :focus to pass through QSA all the time to avoid the IE error
+ // See https://bugs.jquery.com/ticket/13378
+ rbuggyQSA = [];
+
+ if ( (support.qsa = rnative.test( document.querySelectorAll )) ) {
+ // Build QSA regex
+ // Regex strategy adopted from Diego Perini
+ assert(function( el ) {
+ // Select is set to empty string on purpose
+ // This is to test IE's treatment of not explicitly
+ // setting a boolean content attribute,
+ // since its presence should be enough
+ // https://bugs.jquery.com/ticket/12359
+ docElem.appendChild( el ).innerHTML = "" +
+ "";
+
+ // Support: IE8, Opera 11-12.16
+ // Nothing should be selected when empty strings follow ^= or $= or *=
+ // The test attribute must be unknown in Opera but "safe" for WinRT
+ // https://msdn.microsoft.com/en-us/library/ie/hh465388.aspx#attribute_section
+ if ( el.querySelectorAll("[msallowcapture^='']").length ) {
+ rbuggyQSA.push( "[*^$]=" + whitespace + "*(?:''|\"\")" );
+ }
+
+ // Support: IE8
+ // Boolean attributes and "value" are not treated correctly
+ if ( !el.querySelectorAll("[selected]").length ) {
+ rbuggyQSA.push( "\\[" + whitespace + "*(?:value|" + booleans + ")" );
+ }
+
+ // Support: Chrome<29, Android<4.4, Safari<7.0+, iOS<7.0+, PhantomJS<1.9.8+
+ if ( !el.querySelectorAll( "[id~=" + expando + "-]" ).length ) {
+ rbuggyQSA.push("~=");
+ }
+
+ // Webkit/Opera - :checked should return selected option elements
+ // http://www.w3.org/TR/2011/REC-css3-selectors-20110929/#checked
+ // IE8 throws error here and will not see later tests
+ if ( !el.querySelectorAll(":checked").length ) {
+ rbuggyQSA.push(":checked");
+ }
+
+ // Support: Safari 8+, iOS 8+
+ // https://bugs.webkit.org/show_bug.cgi?id=136851
+ // In-page `selector#id sibling-combinator selector` fails
+ if ( !el.querySelectorAll( "a#" + expando + "+*" ).length ) {
+ rbuggyQSA.push(".#.+[+~]");
+ }
+ });
+
+ assert(function( el ) {
+ el.innerHTML = "" +
+ "";
+
+ // Support: Windows 8 Native Apps
+ // The type and name attributes are restricted during .innerHTML assignment
+ var input = document.createElement("input");
+ input.setAttribute( "type", "hidden" );
+ el.appendChild( input ).setAttribute( "name", "D" );
+
+ // Support: IE8
+ // Enforce case-sensitivity of name attribute
+ if ( el.querySelectorAll("[name=d]").length ) {
+ rbuggyQSA.push( "name" + whitespace + "*[*^$|!~]?=" );
+ }
+
+ // FF 3.5 - :enabled/:disabled and hidden elements (hidden elements are still enabled)
+ // IE8 throws error here and will not see later tests
+ if ( el.querySelectorAll(":enabled").length !== 2 ) {
+ rbuggyQSA.push( ":enabled", ":disabled" );
+ }
+
+ // Support: IE9-11+
+ // IE's :disabled selector does not pick up the children of disabled fieldsets
+ docElem.appendChild( el ).disabled = true;
+ if ( el.querySelectorAll(":disabled").length !== 2 ) {
+ rbuggyQSA.push( ":enabled", ":disabled" );
+ }
+
+ // Opera 10-11 does not throw on post-comma invalid pseudos
+ el.querySelectorAll("*,:x");
+ rbuggyQSA.push(",.*:");
+ });
+ }
+
+ if ( (support.matchesSelector = rnative.test( (matches = docElem.matches ||
+ docElem.webkitMatchesSelector ||
+ docElem.mozMatchesSelector ||
+ docElem.oMatchesSelector ||
+ docElem.msMatchesSelector) )) ) {
+
+ assert(function( el ) {
+ // Check to see if it's possible to do matchesSelector
+ // on a disconnected node (IE 9)
+ support.disconnectedMatch = matches.call( el, "*" );
+
+ // This should fail with an exception
+ // Gecko does not error, returns false instead
+ matches.call( el, "[s!='']:x" );
+ rbuggyMatches.push( "!=", pseudos );
+ });
+ }
+
+ rbuggyQSA = rbuggyQSA.length && new RegExp( rbuggyQSA.join("|") );
+ rbuggyMatches = rbuggyMatches.length && new RegExp( rbuggyMatches.join("|") );
+
+ /* Contains
+ ---------------------------------------------------------------------- */
+ hasCompare = rnative.test( docElem.compareDocumentPosition );
+
+ // Element contains another
+ // Purposefully self-exclusive
+ // As in, an element does not contain itself
+ contains = hasCompare || rnative.test( docElem.contains ) ?
+ function( a, b ) {
+ var adown = a.nodeType === 9 ? a.documentElement : a,
+ bup = b && b.parentNode;
+ return a === bup || !!( bup && bup.nodeType === 1 && (
+ adown.contains ?
+ adown.contains( bup ) :
+ a.compareDocumentPosition && a.compareDocumentPosition( bup ) & 16
+ ));
+ } :
+ function( a, b ) {
+ if ( b ) {
+ while ( (b = b.parentNode) ) {
+ if ( b === a ) {
+ return true;
+ }
+ }
+ }
+ return false;
+ };
+
+ /* Sorting
+ ---------------------------------------------------------------------- */
+
+ // Document order sorting
+ sortOrder = hasCompare ?
+ function( a, b ) {
+
+ // Flag for duplicate removal
+ if ( a === b ) {
+ hasDuplicate = true;
+ return 0;
+ }
+
+ // Sort on method existence if only one input has compareDocumentPosition
+ var compare = !a.compareDocumentPosition - !b.compareDocumentPosition;
+ if ( compare ) {
+ return compare;
+ }
+
+ // Calculate position if both inputs belong to the same document
+ compare = ( a.ownerDocument || a ) === ( b.ownerDocument || b ) ?
+ a.compareDocumentPosition( b ) :
+
+ // Otherwise we know they are disconnected
+ 1;
+
+ // Disconnected nodes
+ if ( compare & 1 ||
+ (!support.sortDetached && b.compareDocumentPosition( a ) === compare) ) {
+
+ // Choose the first element that is related to our preferred document
+ if ( a === document || a.ownerDocument === preferredDoc && contains(preferredDoc, a) ) {
+ return -1;
+ }
+ if ( b === document || b.ownerDocument === preferredDoc && contains(preferredDoc, b) ) {
+ return 1;
+ }
+
+ // Maintain original order
+ return sortInput ?
+ ( indexOf( sortInput, a ) - indexOf( sortInput, b ) ) :
+ 0;
+ }
+
+ return compare & 4 ? -1 : 1;
+ } :
+ function( a, b ) {
+ // Exit early if the nodes are identical
+ if ( a === b ) {
+ hasDuplicate = true;
+ return 0;
+ }
+
+ var cur,
+ i = 0,
+ aup = a.parentNode,
+ bup = b.parentNode,
+ ap = [ a ],
+ bp = [ b ];
+
+ // Parentless nodes are either documents or disconnected
+ if ( !aup || !bup ) {
+ return a === document ? -1 :
+ b === document ? 1 :
+ aup ? -1 :
+ bup ? 1 :
+ sortInput ?
+ ( indexOf( sortInput, a ) - indexOf( sortInput, b ) ) :
+ 0;
+
+ // If the nodes are siblings, we can do a quick check
+ } else if ( aup === bup ) {
+ return siblingCheck( a, b );
+ }
+
+ // Otherwise we need full lists of their ancestors for comparison
+ cur = a;
+ while ( (cur = cur.parentNode) ) {
+ ap.unshift( cur );
+ }
+ cur = b;
+ while ( (cur = cur.parentNode) ) {
+ bp.unshift( cur );
+ }
+
+ // Walk down the tree looking for a discrepancy
+ while ( ap[i] === bp[i] ) {
+ i++;
+ }
+
+ return i ?
+ // Do a sibling check if the nodes have a common ancestor
+ siblingCheck( ap[i], bp[i] ) :
+
+ // Otherwise nodes in our document sort first
+ ap[i] === preferredDoc ? -1 :
+ bp[i] === preferredDoc ? 1 :
+ 0;
+ };
+
+ return document;
+};
+
+Sizzle.matches = function( expr, elements ) {
+ return Sizzle( expr, null, null, elements );
+};
+
+Sizzle.matchesSelector = function( elem, expr ) {
+ // Set document vars if needed
+ if ( ( elem.ownerDocument || elem ) !== document ) {
+ setDocument( elem );
+ }
+
+ // Make sure that attribute selectors are quoted
+ expr = expr.replace( rattributeQuotes, "='$1']" );
+
+ if ( support.matchesSelector && documentIsHTML &&
+ !compilerCache[ expr + " " ] &&
+ ( !rbuggyMatches || !rbuggyMatches.test( expr ) ) &&
+ ( !rbuggyQSA || !rbuggyQSA.test( expr ) ) ) {
+
+ try {
+ var ret = matches.call( elem, expr );
+
+ // IE 9's matchesSelector returns false on disconnected nodes
+ if ( ret || support.disconnectedMatch ||
+ // As well, disconnected nodes are said to be in a document
+ // fragment in IE 9
+ elem.document && elem.document.nodeType !== 11 ) {
+ return ret;
+ }
+ } catch (e) {}
+ }
+
+ return Sizzle( expr, document, null, [ elem ] ).length > 0;
+};
+
+Sizzle.contains = function( context, elem ) {
+ // Set document vars if needed
+ if ( ( context.ownerDocument || context ) !== document ) {
+ setDocument( context );
+ }
+ return contains( context, elem );
+};
+
+Sizzle.attr = function( elem, name ) {
+ // Set document vars if needed
+ if ( ( elem.ownerDocument || elem ) !== document ) {
+ setDocument( elem );
+ }
+
+ var fn = Expr.attrHandle[ name.toLowerCase() ],
+ // Don't get fooled by Object.prototype properties (jQuery #13807)
+ val = fn && hasOwn.call( Expr.attrHandle, name.toLowerCase() ) ?
+ fn( elem, name, !documentIsHTML ) :
+ undefined;
+
+ return val !== undefined ?
+ val :
+ support.attributes || !documentIsHTML ?
+ elem.getAttribute( name ) :
+ (val = elem.getAttributeNode(name)) && val.specified ?
+ val.value :
+ null;
+};
+
+Sizzle.escape = function( sel ) {
+ return (sel + "").replace( rcssescape, fcssescape );
+};
+
+Sizzle.error = function( msg ) {
+ throw new Error( "Syntax error, unrecognized expression: " + msg );
+};
+
+/**
+ * Document sorting and removing duplicates
+ * @param {ArrayLike} results
+ */
+Sizzle.uniqueSort = function( results ) {
+ var elem,
+ duplicates = [],
+ j = 0,
+ i = 0;
+
+ // Unless we *know* we can detect duplicates, assume their presence
+ hasDuplicate = !support.detectDuplicates;
+ sortInput = !support.sortStable && results.slice( 0 );
+ results.sort( sortOrder );
+
+ if ( hasDuplicate ) {
+ while ( (elem = results[i++]) ) {
+ if ( elem === results[ i ] ) {
+ j = duplicates.push( i );
+ }
+ }
+ while ( j-- ) {
+ results.splice( duplicates[ j ], 1 );
+ }
+ }
+
+ // Clear input after sorting to release objects
+ // See https://github.com/jquery/sizzle/pull/225
+ sortInput = null;
+
+ return results;
+};
+
+/**
+ * Utility function for retrieving the text value of an array of DOM nodes
+ * @param {Array|Element} elem
+ */
+getText = Sizzle.getText = function( elem ) {
+ var node,
+ ret = "",
+ i = 0,
+ nodeType = elem.nodeType;
+
+ if ( !nodeType ) {
+ // If no nodeType, this is expected to be an array
+ while ( (node = elem[i++]) ) {
+ // Do not traverse comment nodes
+ ret += getText( node );
+ }
+ } else if ( nodeType === 1 || nodeType === 9 || nodeType === 11 ) {
+ // Use textContent for elements
+ // innerText usage removed for consistency of new lines (jQuery #11153)
+ if ( typeof elem.textContent === "string" ) {
+ return elem.textContent;
+ } else {
+ // Traverse its children
+ for ( elem = elem.firstChild; elem; elem = elem.nextSibling ) {
+ ret += getText( elem );
+ }
+ }
+ } else if ( nodeType === 3 || nodeType === 4 ) {
+ return elem.nodeValue;
+ }
+ // Do not include comment or processing instruction nodes
+
+ return ret;
+};
+
+Expr = Sizzle.selectors = {
+
+ // Can be adjusted by the user
+ cacheLength: 50,
+
+ createPseudo: markFunction,
+
+ match: matchExpr,
+
+ attrHandle: {},
+
+ find: {},
+
+ relative: {
+ ">": { dir: "parentNode", first: true },
+ " ": { dir: "parentNode" },
+ "+": { dir: "previousSibling", first: true },
+ "~": { dir: "previousSibling" }
+ },
+
+ preFilter: {
+ "ATTR": function( match ) {
+ match[1] = match[1].replace( runescape, funescape );
+
+ // Move the given value to match[3] whether quoted or unquoted
+ match[3] = ( match[3] || match[4] || match[5] || "" ).replace( runescape, funescape );
+
+ if ( match[2] === "~=" ) {
+ match[3] = " " + match[3] + " ";
+ }
+
+ return match.slice( 0, 4 );
+ },
+
+ "CHILD": function( match ) {
+ /* matches from matchExpr["CHILD"]
+ 1 type (only|nth|...)
+ 2 what (child|of-type)
+ 3 argument (even|odd|\d*|\d*n([+-]\d+)?|...)
+ 4 xn-component of xn+y argument ([+-]?\d*n|)
+ 5 sign of xn-component
+ 6 x of xn-component
+ 7 sign of y-component
+ 8 y of y-component
+ */
+ match[1] = match[1].toLowerCase();
+
+ if ( match[1].slice( 0, 3 ) === "nth" ) {
+ // nth-* requires argument
+ if ( !match[3] ) {
+ Sizzle.error( match[0] );
+ }
+
+ // numeric x and y parameters for Expr.filter.CHILD
+ // remember that false/true cast respectively to 0/1
+ match[4] = +( match[4] ? match[5] + (match[6] || 1) : 2 * ( match[3] === "even" || match[3] === "odd" ) );
+ match[5] = +( ( match[7] + match[8] ) || match[3] === "odd" );
+
+ // other types prohibit arguments
+ } else if ( match[3] ) {
+ Sizzle.error( match[0] );
+ }
+
+ return match;
+ },
+
+ "PSEUDO": function( match ) {
+ var excess,
+ unquoted = !match[6] && match[2];
+
+ if ( matchExpr["CHILD"].test( match[0] ) ) {
+ return null;
+ }
+
+ // Accept quoted arguments as-is
+ if ( match[3] ) {
+ match[2] = match[4] || match[5] || "";
+
+ // Strip excess characters from unquoted arguments
+ } else if ( unquoted && rpseudo.test( unquoted ) &&
+ // Get excess from tokenize (recursively)
+ (excess = tokenize( unquoted, true )) &&
+ // advance to the next closing parenthesis
+ (excess = unquoted.indexOf( ")", unquoted.length - excess ) - unquoted.length) ) {
+
+ // excess is a negative index
+ match[0] = match[0].slice( 0, excess );
+ match[2] = unquoted.slice( 0, excess );
+ }
+
+ // Return only captures needed by the pseudo filter method (type and argument)
+ return match.slice( 0, 3 );
+ }
+ },
+
+ filter: {
+
+ "TAG": function( nodeNameSelector ) {
+ var nodeName = nodeNameSelector.replace( runescape, funescape ).toLowerCase();
+ return nodeNameSelector === "*" ?
+ function() { return true; } :
+ function( elem ) {
+ return elem.nodeName && elem.nodeName.toLowerCase() === nodeName;
+ };
+ },
+
+ "CLASS": function( className ) {
+ var pattern = classCache[ className + " " ];
+
+ return pattern ||
+ (pattern = new RegExp( "(^|" + whitespace + ")" + className + "(" + whitespace + "|$)" )) &&
+ classCache( className, function( elem ) {
+ return pattern.test( typeof elem.className === "string" && elem.className || typeof elem.getAttribute !== "undefined" && elem.getAttribute("class") || "" );
+ });
+ },
+
+ "ATTR": function( name, operator, check ) {
+ return function( elem ) {
+ var result = Sizzle.attr( elem, name );
+
+ if ( result == null ) {
+ return operator === "!=";
+ }
+ if ( !operator ) {
+ return true;
+ }
+
+ result += "";
+
+ return operator === "=" ? result === check :
+ operator === "!=" ? result !== check :
+ operator === "^=" ? check && result.indexOf( check ) === 0 :
+ operator === "*=" ? check && result.indexOf( check ) > -1 :
+ operator === "$=" ? check && result.slice( -check.length ) === check :
+ operator === "~=" ? ( " " + result.replace( rwhitespace, " " ) + " " ).indexOf( check ) > -1 :
+ operator === "|=" ? result === check || result.slice( 0, check.length + 1 ) === check + "-" :
+ false;
+ };
+ },
+
+ "CHILD": function( type, what, argument, first, last ) {
+ var simple = type.slice( 0, 3 ) !== "nth",
+ forward = type.slice( -4 ) !== "last",
+ ofType = what === "of-type";
+
+ return first === 1 && last === 0 ?
+
+ // Shortcut for :nth-*(n)
+ function( elem ) {
+ return !!elem.parentNode;
+ } :
+
+ function( elem, context, xml ) {
+ var cache, uniqueCache, outerCache, node, nodeIndex, start,
+ dir = simple !== forward ? "nextSibling" : "previousSibling",
+ parent = elem.parentNode,
+ name = ofType && elem.nodeName.toLowerCase(),
+ useCache = !xml && !ofType,
+ diff = false;
+
+ if ( parent ) {
+
+ // :(first|last|only)-(child|of-type)
+ if ( simple ) {
+ while ( dir ) {
+ node = elem;
+ while ( (node = node[ dir ]) ) {
+ if ( ofType ?
+ node.nodeName.toLowerCase() === name :
+ node.nodeType === 1 ) {
+
+ return false;
+ }
+ }
+ // Reverse direction for :only-* (if we haven't yet done so)
+ start = dir = type === "only" && !start && "nextSibling";
+ }
+ return true;
+ }
+
+ start = [ forward ? parent.firstChild : parent.lastChild ];
+
+ // non-xml :nth-child(...) stores cache data on `parent`
+ if ( forward && useCache ) {
+
+ // Seek `elem` from a previously-cached index
+
+ // ...in a gzip-friendly way
+ node = parent;
+ outerCache = node[ expando ] || (node[ expando ] = {});
+
+ // Support: IE <9 only
+ // Defend against cloned attroperties (jQuery gh-1709)
+ uniqueCache = outerCache[ node.uniqueID ] ||
+ (outerCache[ node.uniqueID ] = {});
+
+ cache = uniqueCache[ type ] || [];
+ nodeIndex = cache[ 0 ] === dirruns && cache[ 1 ];
+ diff = nodeIndex && cache[ 2 ];
+ node = nodeIndex && parent.childNodes[ nodeIndex ];
+
+ while ( (node = ++nodeIndex && node && node[ dir ] ||
+
+ // Fallback to seeking `elem` from the start
+ (diff = nodeIndex = 0) || start.pop()) ) {
+
+ // When found, cache indexes on `parent` and break
+ if ( node.nodeType === 1 && ++diff && node === elem ) {
+ uniqueCache[ type ] = [ dirruns, nodeIndex, diff ];
+ break;
+ }
+ }
+
+ } else {
+ // Use previously-cached element index if available
+ if ( useCache ) {
+ // ...in a gzip-friendly way
+ node = elem;
+ outerCache = node[ expando ] || (node[ expando ] = {});
+
+ // Support: IE <9 only
+ // Defend against cloned attroperties (jQuery gh-1709)
+ uniqueCache = outerCache[ node.uniqueID ] ||
+ (outerCache[ node.uniqueID ] = {});
+
+ cache = uniqueCache[ type ] || [];
+ nodeIndex = cache[ 0 ] === dirruns && cache[ 1 ];
+ diff = nodeIndex;
+ }
+
+ // xml :nth-child(...)
+ // or :nth-last-child(...) or :nth(-last)?-of-type(...)
+ if ( diff === false ) {
+ // Use the same loop as above to seek `elem` from the start
+ while ( (node = ++nodeIndex && node && node[ dir ] ||
+ (diff = nodeIndex = 0) || start.pop()) ) {
+
+ if ( ( ofType ?
+ node.nodeName.toLowerCase() === name :
+ node.nodeType === 1 ) &&
+ ++diff ) {
+
+ // Cache the index of each encountered element
+ if ( useCache ) {
+ outerCache = node[ expando ] || (node[ expando ] = {});
+
+ // Support: IE <9 only
+ // Defend against cloned attroperties (jQuery gh-1709)
+ uniqueCache = outerCache[ node.uniqueID ] ||
+ (outerCache[ node.uniqueID ] = {});
+
+ uniqueCache[ type ] = [ dirruns, diff ];
+ }
+
+ if ( node === elem ) {
+ break;
+ }
+ }
+ }
+ }
+ }
+
+ // Incorporate the offset, then check against cycle size
+ diff -= last;
+ return diff === first || ( diff % first === 0 && diff / first >= 0 );
+ }
+ };
+ },
+
+ "PSEUDO": function( pseudo, argument ) {
+ // pseudo-class names are case-insensitive
+ // http://www.w3.org/TR/selectors/#pseudo-classes
+ // Prioritize by case sensitivity in case custom pseudos are added with uppercase letters
+ // Remember that setFilters inherits from pseudos
+ var args,
+ fn = Expr.pseudos[ pseudo ] || Expr.setFilters[ pseudo.toLowerCase() ] ||
+ Sizzle.error( "unsupported pseudo: " + pseudo );
+
+ // The user may use createPseudo to indicate that
+ // arguments are needed to create the filter function
+ // just as Sizzle does
+ if ( fn[ expando ] ) {
+ return fn( argument );
+ }
+
+ // But maintain support for old signatures
+ if ( fn.length > 1 ) {
+ args = [ pseudo, pseudo, "", argument ];
+ return Expr.setFilters.hasOwnProperty( pseudo.toLowerCase() ) ?
+ markFunction(function( seed, matches ) {
+ var idx,
+ matched = fn( seed, argument ),
+ i = matched.length;
+ while ( i-- ) {
+ idx = indexOf( seed, matched[i] );
+ seed[ idx ] = !( matches[ idx ] = matched[i] );
+ }
+ }) :
+ function( elem ) {
+ return fn( elem, 0, args );
+ };
+ }
+
+ return fn;
+ }
+ },
+
+ pseudos: {
+ // Potentially complex pseudos
+ "not": markFunction(function( selector ) {
+ // Trim the selector passed to compile
+ // to avoid treating leading and trailing
+ // spaces as combinators
+ var input = [],
+ results = [],
+ matcher = compile( selector.replace( rtrim, "$1" ) );
+
+ return matcher[ expando ] ?
+ markFunction(function( seed, matches, context, xml ) {
+ var elem,
+ unmatched = matcher( seed, null, xml, [] ),
+ i = seed.length;
+
+ // Match elements unmatched by `matcher`
+ while ( i-- ) {
+ if ( (elem = unmatched[i]) ) {
+ seed[i] = !(matches[i] = elem);
+ }
+ }
+ }) :
+ function( elem, context, xml ) {
+ input[0] = elem;
+ matcher( input, null, xml, results );
+ // Don't keep the element (issue #299)
+ input[0] = null;
+ return !results.pop();
+ };
+ }),
+
+ "has": markFunction(function( selector ) {
+ return function( elem ) {
+ return Sizzle( selector, elem ).length > 0;
+ };
+ }),
+
+ "contains": markFunction(function( text ) {
+ text = text.replace( runescape, funescape );
+ return function( elem ) {
+ return ( elem.textContent || elem.innerText || getText( elem ) ).indexOf( text ) > -1;
+ };
+ }),
+
+ // "Whether an element is represented by a :lang() selector
+ // is based solely on the element's language value
+ // being equal to the identifier C,
+ // or beginning with the identifier C immediately followed by "-".
+ // The matching of C against the element's language value is performed case-insensitively.
+ // The identifier C does not have to be a valid language name."
+ // http://www.w3.org/TR/selectors/#lang-pseudo
+ "lang": markFunction( function( lang ) {
+ // lang value must be a valid identifier
+ if ( !ridentifier.test(lang || "") ) {
+ Sizzle.error( "unsupported lang: " + lang );
+ }
+ lang = lang.replace( runescape, funescape ).toLowerCase();
+ return function( elem ) {
+ var elemLang;
+ do {
+ if ( (elemLang = documentIsHTML ?
+ elem.lang :
+ elem.getAttribute("xml:lang") || elem.getAttribute("lang")) ) {
+
+ elemLang = elemLang.toLowerCase();
+ return elemLang === lang || elemLang.indexOf( lang + "-" ) === 0;
+ }
+ } while ( (elem = elem.parentNode) && elem.nodeType === 1 );
+ return false;
+ };
+ }),
+
+ // Miscellaneous
+ "target": function( elem ) {
+ var hash = window.location && window.location.hash;
+ return hash && hash.slice( 1 ) === elem.id;
+ },
+
+ "root": function( elem ) {
+ return elem === docElem;
+ },
+
+ "focus": function( elem ) {
+ return elem === document.activeElement && (!document.hasFocus || document.hasFocus()) && !!(elem.type || elem.href || ~elem.tabIndex);
+ },
+
+ // Boolean properties
+ "enabled": createDisabledPseudo( false ),
+ "disabled": createDisabledPseudo( true ),
+
+ "checked": function( elem ) {
+ // In CSS3, :checked should return both checked and selected elements
+ // http://www.w3.org/TR/2011/REC-css3-selectors-20110929/#checked
+ var nodeName = elem.nodeName.toLowerCase();
+ return (nodeName === "input" && !!elem.checked) || (nodeName === "option" && !!elem.selected);
+ },
+
+ "selected": function( elem ) {
+ // Accessing this property makes selected-by-default
+ // options in Safari work properly
+ if ( elem.parentNode ) {
+ elem.parentNode.selectedIndex;
+ }
+
+ return elem.selected === true;
+ },
+
+ // Contents
+ "empty": function( elem ) {
+ // http://www.w3.org/TR/selectors/#empty-pseudo
+ // :empty is negated by element (1) or content nodes (text: 3; cdata: 4; entity ref: 5),
+ // but not by others (comment: 8; processing instruction: 7; etc.)
+ // nodeType < 6 works because attributes (2) do not appear as children
+ for ( elem = elem.firstChild; elem; elem = elem.nextSibling ) {
+ if ( elem.nodeType < 6 ) {
+ return false;
+ }
+ }
+ return true;
+ },
+
+ "parent": function( elem ) {
+ return !Expr.pseudos["empty"]( elem );
+ },
+
+ // Element/input types
+ "header": function( elem ) {
+ return rheader.test( elem.nodeName );
+ },
+
+ "input": function( elem ) {
+ return rinputs.test( elem.nodeName );
+ },
+
+ "button": function( elem ) {
+ var name = elem.nodeName.toLowerCase();
+ return name === "input" && elem.type === "button" || name === "button";
+ },
+
+ "text": function( elem ) {
+ var attr;
+ return elem.nodeName.toLowerCase() === "input" &&
+ elem.type === "text" &&
+
+ // Support: IE<8
+ // New HTML5 attribute values (e.g., "search") appear with elem.type === "text"
+ ( (attr = elem.getAttribute("type")) == null || attr.toLowerCase() === "text" );
+ },
+
+ // Position-in-collection
+ "first": createPositionalPseudo(function() {
+ return [ 0 ];
+ }),
+
+ "last": createPositionalPseudo(function( matchIndexes, length ) {
+ return [ length - 1 ];
+ }),
+
+ "eq": createPositionalPseudo(function( matchIndexes, length, argument ) {
+ return [ argument < 0 ? argument + length : argument ];
+ }),
+
+ "even": createPositionalPseudo(function( matchIndexes, length ) {
+ var i = 0;
+ for ( ; i < length; i += 2 ) {
+ matchIndexes.push( i );
+ }
+ return matchIndexes;
+ }),
+
+ "odd": createPositionalPseudo(function( matchIndexes, length ) {
+ var i = 1;
+ for ( ; i < length; i += 2 ) {
+ matchIndexes.push( i );
+ }
+ return matchIndexes;
+ }),
+
+ "lt": createPositionalPseudo(function( matchIndexes, length, argument ) {
+ var i = argument < 0 ? argument + length : argument;
+ for ( ; --i >= 0; ) {
+ matchIndexes.push( i );
+ }
+ return matchIndexes;
+ }),
+
+ "gt": createPositionalPseudo(function( matchIndexes, length, argument ) {
+ var i = argument < 0 ? argument + length : argument;
+ for ( ; ++i < length; ) {
+ matchIndexes.push( i );
+ }
+ return matchIndexes;
+ })
+ }
+};
+
+Expr.pseudos["nth"] = Expr.pseudos["eq"];
+
+// Add button/input type pseudos
+for ( i in { radio: true, checkbox: true, file: true, password: true, image: true } ) {
+ Expr.pseudos[ i ] = createInputPseudo( i );
+}
+for ( i in { submit: true, reset: true } ) {
+ Expr.pseudos[ i ] = createButtonPseudo( i );
+}
+
+// Easy API for creating new setFilters
+function setFilters() {}
+setFilters.prototype = Expr.filters = Expr.pseudos;
+Expr.setFilters = new setFilters();
+
+tokenize = Sizzle.tokenize = function( selector, parseOnly ) {
+ var matched, match, tokens, type,
+ soFar, groups, preFilters,
+ cached = tokenCache[ selector + " " ];
+
+ if ( cached ) {
+ return parseOnly ? 0 : cached.slice( 0 );
+ }
+
+ soFar = selector;
+ groups = [];
+ preFilters = Expr.preFilter;
+
+ while ( soFar ) {
+
+ // Comma and first run
+ if ( !matched || (match = rcomma.exec( soFar )) ) {
+ if ( match ) {
+ // Don't consume trailing commas as valid
+ soFar = soFar.slice( match[0].length ) || soFar;
+ }
+ groups.push( (tokens = []) );
+ }
+
+ matched = false;
+
+ // Combinators
+ if ( (match = rcombinators.exec( soFar )) ) {
+ matched = match.shift();
+ tokens.push({
+ value: matched,
+ // Cast descendant combinators to space
+ type: match[0].replace( rtrim, " " )
+ });
+ soFar = soFar.slice( matched.length );
+ }
+
+ // Filters
+ for ( type in Expr.filter ) {
+ if ( (match = matchExpr[ type ].exec( soFar )) && (!preFilters[ type ] ||
+ (match = preFilters[ type ]( match ))) ) {
+ matched = match.shift();
+ tokens.push({
+ value: matched,
+ type: type,
+ matches: match
+ });
+ soFar = soFar.slice( matched.length );
+ }
+ }
+
+ if ( !matched ) {
+ break;
+ }
+ }
+
+ // Return the length of the invalid excess
+ // if we're just parsing
+ // Otherwise, throw an error or return tokens
+ return parseOnly ?
+ soFar.length :
+ soFar ?
+ Sizzle.error( selector ) :
+ // Cache the tokens
+ tokenCache( selector, groups ).slice( 0 );
+};
+
+function toSelector( tokens ) {
+ var i = 0,
+ len = tokens.length,
+ selector = "";
+ for ( ; i < len; i++ ) {
+ selector += tokens[i].value;
+ }
+ return selector;
+}
+
+function addCombinator( matcher, combinator, base ) {
+ var dir = combinator.dir,
+ skip = combinator.next,
+ key = skip || dir,
+ checkNonElements = base && key === "parentNode",
+ doneName = done++;
+
+ return combinator.first ?
+ // Check against closest ancestor/preceding element
+ function( elem, context, xml ) {
+ while ( (elem = elem[ dir ]) ) {
+ if ( elem.nodeType === 1 || checkNonElements ) {
+ return matcher( elem, context, xml );
+ }
+ }
+ return false;
+ } :
+
+ // Check against all ancestor/preceding elements
+ function( elem, context, xml ) {
+ var oldCache, uniqueCache, outerCache,
+ newCache = [ dirruns, doneName ];
+
+ // We can't set arbitrary data on XML nodes, so they don't benefit from combinator caching
+ if ( xml ) {
+ while ( (elem = elem[ dir ]) ) {
+ if ( elem.nodeType === 1 || checkNonElements ) {
+ if ( matcher( elem, context, xml ) ) {
+ return true;
+ }
+ }
+ }
+ } else {
+ while ( (elem = elem[ dir ]) ) {
+ if ( elem.nodeType === 1 || checkNonElements ) {
+ outerCache = elem[ expando ] || (elem[ expando ] = {});
+
+ // Support: IE <9 only
+ // Defend against cloned attroperties (jQuery gh-1709)
+ uniqueCache = outerCache[ elem.uniqueID ] || (outerCache[ elem.uniqueID ] = {});
+
+ if ( skip && skip === elem.nodeName.toLowerCase() ) {
+ elem = elem[ dir ] || elem;
+ } else if ( (oldCache = uniqueCache[ key ]) &&
+ oldCache[ 0 ] === dirruns && oldCache[ 1 ] === doneName ) {
+
+ // Assign to newCache so results back-propagate to previous elements
+ return (newCache[ 2 ] = oldCache[ 2 ]);
+ } else {
+ // Reuse newcache so results back-propagate to previous elements
+ uniqueCache[ key ] = newCache;
+
+ // A match means we're done; a fail means we have to keep checking
+ if ( (newCache[ 2 ] = matcher( elem, context, xml )) ) {
+ return true;
+ }
+ }
+ }
+ }
+ }
+ return false;
+ };
+}
+
+function elementMatcher( matchers ) {
+ return matchers.length > 1 ?
+ function( elem, context, xml ) {
+ var i = matchers.length;
+ while ( i-- ) {
+ if ( !matchers[i]( elem, context, xml ) ) {
+ return false;
+ }
+ }
+ return true;
+ } :
+ matchers[0];
+}
+
+function multipleContexts( selector, contexts, results ) {
+ var i = 0,
+ len = contexts.length;
+ for ( ; i < len; i++ ) {
+ Sizzle( selector, contexts[i], results );
+ }
+ return results;
+}
+
+function condense( unmatched, map, filter, context, xml ) {
+ var elem,
+ newUnmatched = [],
+ i = 0,
+ len = unmatched.length,
+ mapped = map != null;
+
+ for ( ; i < len; i++ ) {
+ if ( (elem = unmatched[i]) ) {
+ if ( !filter || filter( elem, context, xml ) ) {
+ newUnmatched.push( elem );
+ if ( mapped ) {
+ map.push( i );
+ }
+ }
+ }
+ }
+
+ return newUnmatched;
+}
+
+function setMatcher( preFilter, selector, matcher, postFilter, postFinder, postSelector ) {
+ if ( postFilter && !postFilter[ expando ] ) {
+ postFilter = setMatcher( postFilter );
+ }
+ if ( postFinder && !postFinder[ expando ] ) {
+ postFinder = setMatcher( postFinder, postSelector );
+ }
+ return markFunction(function( seed, results, context, xml ) {
+ var temp, i, elem,
+ preMap = [],
+ postMap = [],
+ preexisting = results.length,
+
+ // Get initial elements from seed or context
+ elems = seed || multipleContexts( selector || "*", context.nodeType ? [ context ] : context, [] ),
+
+ // Prefilter to get matcher input, preserving a map for seed-results synchronization
+ matcherIn = preFilter && ( seed || !selector ) ?
+ condense( elems, preMap, preFilter, context, xml ) :
+ elems,
+
+ matcherOut = matcher ?
+ // If we have a postFinder, or filtered seed, or non-seed postFilter or preexisting results,
+ postFinder || ( seed ? preFilter : preexisting || postFilter ) ?
+
+ // ...intermediate processing is necessary
+ [] :
+
+ // ...otherwise use results directly
+ results :
+ matcherIn;
+
+ // Find primary matches
+ if ( matcher ) {
+ matcher( matcherIn, matcherOut, context, xml );
+ }
+
+ // Apply postFilter
+ if ( postFilter ) {
+ temp = condense( matcherOut, postMap );
+ postFilter( temp, [], context, xml );
+
+ // Un-match failing elements by moving them back to matcherIn
+ i = temp.length;
+ while ( i-- ) {
+ if ( (elem = temp[i]) ) {
+ matcherOut[ postMap[i] ] = !(matcherIn[ postMap[i] ] = elem);
+ }
+ }
+ }
+
+ if ( seed ) {
+ if ( postFinder || preFilter ) {
+ if ( postFinder ) {
+ // Get the final matcherOut by condensing this intermediate into postFinder contexts
+ temp = [];
+ i = matcherOut.length;
+ while ( i-- ) {
+ if ( (elem = matcherOut[i]) ) {
+ // Restore matcherIn since elem is not yet a final match
+ temp.push( (matcherIn[i] = elem) );
+ }
+ }
+ postFinder( null, (matcherOut = []), temp, xml );
+ }
+
+ // Move matched elements from seed to results to keep them synchronized
+ i = matcherOut.length;
+ while ( i-- ) {
+ if ( (elem = matcherOut[i]) &&
+ (temp = postFinder ? indexOf( seed, elem ) : preMap[i]) > -1 ) {
+
+ seed[temp] = !(results[temp] = elem);
+ }
+ }
+ }
+
+ // Add elements to results, through postFinder if defined
+ } else {
+ matcherOut = condense(
+ matcherOut === results ?
+ matcherOut.splice( preexisting, matcherOut.length ) :
+ matcherOut
+ );
+ if ( postFinder ) {
+ postFinder( null, results, matcherOut, xml );
+ } else {
+ push.apply( results, matcherOut );
+ }
+ }
+ });
+}
+
+function matcherFromTokens( tokens ) {
+ var checkContext, matcher, j,
+ len = tokens.length,
+ leadingRelative = Expr.relative[ tokens[0].type ],
+ implicitRelative = leadingRelative || Expr.relative[" "],
+ i = leadingRelative ? 1 : 0,
+
+ // The foundational matcher ensures that elements are reachable from top-level context(s)
+ matchContext = addCombinator( function( elem ) {
+ return elem === checkContext;
+ }, implicitRelative, true ),
+ matchAnyContext = addCombinator( function( elem ) {
+ return indexOf( checkContext, elem ) > -1;
+ }, implicitRelative, true ),
+ matchers = [ function( elem, context, xml ) {
+ var ret = ( !leadingRelative && ( xml || context !== outermostContext ) ) || (
+ (checkContext = context).nodeType ?
+ matchContext( elem, context, xml ) :
+ matchAnyContext( elem, context, xml ) );
+ // Avoid hanging onto element (issue #299)
+ checkContext = null;
+ return ret;
+ } ];
+
+ for ( ; i < len; i++ ) {
+ if ( (matcher = Expr.relative[ tokens[i].type ]) ) {
+ matchers = [ addCombinator(elementMatcher( matchers ), matcher) ];
+ } else {
+ matcher = Expr.filter[ tokens[i].type ].apply( null, tokens[i].matches );
+
+ // Return special upon seeing a positional matcher
+ if ( matcher[ expando ] ) {
+ // Find the next relative operator (if any) for proper handling
+ j = ++i;
+ for ( ; j < len; j++ ) {
+ if ( Expr.relative[ tokens[j].type ] ) {
+ break;
+ }
+ }
+ return setMatcher(
+ i > 1 && elementMatcher( matchers ),
+ i > 1 && toSelector(
+ // If the preceding token was a descendant combinator, insert an implicit any-element `*`
+ tokens.slice( 0, i - 1 ).concat({ value: tokens[ i - 2 ].type === " " ? "*" : "" })
+ ).replace( rtrim, "$1" ),
+ matcher,
+ i < j && matcherFromTokens( tokens.slice( i, j ) ),
+ j < len && matcherFromTokens( (tokens = tokens.slice( j )) ),
+ j < len && toSelector( tokens )
+ );
+ }
+ matchers.push( matcher );
+ }
+ }
+
+ return elementMatcher( matchers );
+}
+
+function matcherFromGroupMatchers( elementMatchers, setMatchers ) {
+ var bySet = setMatchers.length > 0,
+ byElement = elementMatchers.length > 0,
+ superMatcher = function( seed, context, xml, results, outermost ) {
+ var elem, j, matcher,
+ matchedCount = 0,
+ i = "0",
+ unmatched = seed && [],
+ setMatched = [],
+ contextBackup = outermostContext,
+ // We must always have either seed elements or outermost context
+ elems = seed || byElement && Expr.find["TAG"]( "*", outermost ),
+ // Use integer dirruns iff this is the outermost matcher
+ dirrunsUnique = (dirruns += contextBackup == null ? 1 : Math.random() || 0.1),
+ len = elems.length;
+
+ if ( outermost ) {
+ outermostContext = context === document || context || outermost;
+ }
+
+ // Add elements passing elementMatchers directly to results
+ // Support: IE<9, Safari
+ // Tolerate NodeList properties (IE: "length"; Safari: ) matching elements by id
+ for ( ; i !== len && (elem = elems[i]) != null; i++ ) {
+ if ( byElement && elem ) {
+ j = 0;
+ if ( !context && elem.ownerDocument !== document ) {
+ setDocument( elem );
+ xml = !documentIsHTML;
+ }
+ while ( (matcher = elementMatchers[j++]) ) {
+ if ( matcher( elem, context || document, xml) ) {
+ results.push( elem );
+ break;
+ }
+ }
+ if ( outermost ) {
+ dirruns = dirrunsUnique;
+ }
+ }
+
+ // Track unmatched elements for set filters
+ if ( bySet ) {
+ // They will have gone through all possible matchers
+ if ( (elem = !matcher && elem) ) {
+ matchedCount--;
+ }
+
+ // Lengthen the array for every element, matched or not
+ if ( seed ) {
+ unmatched.push( elem );
+ }
+ }
+ }
+
+ // `i` is now the count of elements visited above, and adding it to `matchedCount`
+ // makes the latter nonnegative.
+ matchedCount += i;
+
+ // Apply set filters to unmatched elements
+ // NOTE: This can be skipped if there are no unmatched elements (i.e., `matchedCount`
+ // equals `i`), unless we didn't visit _any_ elements in the above loop because we have
+ // no element matchers and no seed.
+ // Incrementing an initially-string "0" `i` allows `i` to remain a string only in that
+ // case, which will result in a "00" `matchedCount` that differs from `i` but is also
+ // numerically zero.
+ if ( bySet && i !== matchedCount ) {
+ j = 0;
+ while ( (matcher = setMatchers[j++]) ) {
+ matcher( unmatched, setMatched, context, xml );
+ }
+
+ if ( seed ) {
+ // Reintegrate element matches to eliminate the need for sorting
+ if ( matchedCount > 0 ) {
+ while ( i-- ) {
+ if ( !(unmatched[i] || setMatched[i]) ) {
+ setMatched[i] = pop.call( results );
+ }
+ }
+ }
+
+ // Discard index placeholder values to get only actual matches
+ setMatched = condense( setMatched );
+ }
+
+ // Add matches to results
+ push.apply( results, setMatched );
+
+ // Seedless set matches succeeding multiple successful matchers stipulate sorting
+ if ( outermost && !seed && setMatched.length > 0 &&
+ ( matchedCount + setMatchers.length ) > 1 ) {
+
+ Sizzle.uniqueSort( results );
+ }
+ }
+
+ // Override manipulation of globals by nested matchers
+ if ( outermost ) {
+ dirruns = dirrunsUnique;
+ outermostContext = contextBackup;
+ }
+
+ return unmatched;
+ };
+
+ return bySet ?
+ markFunction( superMatcher ) :
+ superMatcher;
+}
+
+compile = Sizzle.compile = function( selector, match /* Internal Use Only */ ) {
+ var i,
+ setMatchers = [],
+ elementMatchers = [],
+ cached = compilerCache[ selector + " " ];
+
+ if ( !cached ) {
+ // Generate a function of recursive functions that can be used to check each element
+ if ( !match ) {
+ match = tokenize( selector );
+ }
+ i = match.length;
+ while ( i-- ) {
+ cached = matcherFromTokens( match[i] );
+ if ( cached[ expando ] ) {
+ setMatchers.push( cached );
+ } else {
+ elementMatchers.push( cached );
+ }
+ }
+
+ // Cache the compiled function
+ cached = compilerCache( selector, matcherFromGroupMatchers( elementMatchers, setMatchers ) );
+
+ // Save selector and tokenization
+ cached.selector = selector;
+ }
+ return cached;
+};
+
+/**
+ * A low-level selection function that works with Sizzle's compiled
+ * selector functions
+ * @param {String|Function} selector A selector or a pre-compiled
+ * selector function built with Sizzle.compile
+ * @param {Element} context
+ * @param {Array} [results]
+ * @param {Array} [seed] A set of elements to match against
+ */
+select = Sizzle.select = function( selector, context, results, seed ) {
+ var i, tokens, token, type, find,
+ compiled = typeof selector === "function" && selector,
+ match = !seed && tokenize( (selector = compiled.selector || selector) );
+
+ results = results || [];
+
+ // Try to minimize operations if there is only one selector in the list and no seed
+ // (the latter of which guarantees us context)
+ if ( match.length === 1 ) {
+
+ // Reduce context if the leading compound selector is an ID
+ tokens = match[0] = match[0].slice( 0 );
+ if ( tokens.length > 2 && (token = tokens[0]).type === "ID" &&
+ context.nodeType === 9 && documentIsHTML && Expr.relative[ tokens[1].type ] ) {
+
+ context = ( Expr.find["ID"]( token.matches[0].replace(runescape, funescape), context ) || [] )[0];
+ if ( !context ) {
+ return results;
+
+ // Precompiled matchers will still verify ancestry, so step up a level
+ } else if ( compiled ) {
+ context = context.parentNode;
+ }
+
+ selector = selector.slice( tokens.shift().value.length );
+ }
+
+ // Fetch a seed set for right-to-left matching
+ i = matchExpr["needsContext"].test( selector ) ? 0 : tokens.length;
+ while ( i-- ) {
+ token = tokens[i];
+
+ // Abort if we hit a combinator
+ if ( Expr.relative[ (type = token.type) ] ) {
+ break;
+ }
+ if ( (find = Expr.find[ type ]) ) {
+ // Search, expanding context for leading sibling combinators
+ if ( (seed = find(
+ token.matches[0].replace( runescape, funescape ),
+ rsibling.test( tokens[0].type ) && testContext( context.parentNode ) || context
+ )) ) {
+
+ // If seed is empty or no tokens remain, we can return early
+ tokens.splice( i, 1 );
+ selector = seed.length && toSelector( tokens );
+ if ( !selector ) {
+ push.apply( results, seed );
+ return results;
+ }
+
+ break;
+ }
+ }
+ }
+ }
+
+ // Compile and execute a filtering function if one is not provided
+ // Provide `match` to avoid retokenization if we modified the selector above
+ ( compiled || compile( selector, match ) )(
+ seed,
+ context,
+ !documentIsHTML,
+ results,
+ !context || rsibling.test( selector ) && testContext( context.parentNode ) || context
+ );
+ return results;
+};
+
+// One-time assignments
+
+// Sort stability
+support.sortStable = expando.split("").sort( sortOrder ).join("") === expando;
+
+// Support: Chrome 14-35+
+// Always assume duplicates if they aren't passed to the comparison function
+support.detectDuplicates = !!hasDuplicate;
+
+// Initialize against the default document
+setDocument();
+
+// Support: Webkit<537.32 - Safari 6.0.3/Chrome 25 (fixed in Chrome 27)
+// Detached nodes confoundingly follow *each other*
+support.sortDetached = assert(function( el ) {
+ // Should return 1, but returns 4 (following)
+ return el.compareDocumentPosition( document.createElement("fieldset") ) & 1;
+});
+
+// Support: IE<8
+// Prevent attribute/property "interpolation"
+// https://msdn.microsoft.com/en-us/library/ms536429%28VS.85%29.aspx
+if ( !assert(function( el ) {
+ el.innerHTML = "";
+ return el.firstChild.getAttribute("href") === "#" ;
+}) ) {
+ addHandle( "type|href|height|width", function( elem, name, isXML ) {
+ if ( !isXML ) {
+ return elem.getAttribute( name, name.toLowerCase() === "type" ? 1 : 2 );
+ }
+ });
+}
+
+// Support: IE<9
+// Use defaultValue in place of getAttribute("value")
+if ( !support.attributes || !assert(function( el ) {
+ el.innerHTML = "";
+ el.firstChild.setAttribute( "value", "" );
+ return el.firstChild.getAttribute( "value" ) === "";
+}) ) {
+ addHandle( "value", function( elem, name, isXML ) {
+ if ( !isXML && elem.nodeName.toLowerCase() === "input" ) {
+ return elem.defaultValue;
+ }
+ });
+}
+
+// Support: IE<9
+// Use getAttributeNode to fetch booleans when getAttribute lies
+if ( !assert(function( el ) {
+ return el.getAttribute("disabled") == null;
+}) ) {
+ addHandle( booleans, function( elem, name, isXML ) {
+ var val;
+ if ( !isXML ) {
+ return elem[ name ] === true ? name.toLowerCase() :
+ (val = elem.getAttributeNode( name )) && val.specified ?
+ val.value :
+ null;
+ }
+ });
+}
+
+return Sizzle;
+
+})( window );
+
+
+
+jQuery.find = Sizzle;
+jQuery.expr = Sizzle.selectors;
+
+// Deprecated
+jQuery.expr[ ":" ] = jQuery.expr.pseudos;
+jQuery.uniqueSort = jQuery.unique = Sizzle.uniqueSort;
+jQuery.text = Sizzle.getText;
+jQuery.isXMLDoc = Sizzle.isXML;
+jQuery.contains = Sizzle.contains;
+jQuery.escapeSelector = Sizzle.escape;
+
+
+
+
+var dir = function( elem, dir, until ) {
+ var matched = [],
+ truncate = until !== undefined;
+
+ while ( ( elem = elem[ dir ] ) && elem.nodeType !== 9 ) {
+ if ( elem.nodeType === 1 ) {
+ if ( truncate && jQuery( elem ).is( until ) ) {
+ break;
+ }
+ matched.push( elem );
+ }
+ }
+ return matched;
+};
+
+
+var siblings = function( n, elem ) {
+ var matched = [];
+
+ for ( ; n; n = n.nextSibling ) {
+ if ( n.nodeType === 1 && n !== elem ) {
+ matched.push( n );
+ }
+ }
+
+ return matched;
+};
+
+
+var rneedsContext = jQuery.expr.match.needsContext;
+
+
+
+function nodeName( elem, name ) {
+
+ return elem.nodeName && elem.nodeName.toLowerCase() === name.toLowerCase();
+
+};
+var rsingleTag = ( /^<([a-z][^\/\0>:\x20\t\r\n\f]*)[\x20\t\r\n\f]*\/?>(?:<\/\1>|)$/i );
+
+
+
+var risSimple = /^.[^:#\[\.,]*$/;
+
+// Implement the identical functionality for filter and not
+function winnow( elements, qualifier, not ) {
+ if ( jQuery.isFunction( qualifier ) ) {
+ return jQuery.grep( elements, function( elem, i ) {
+ return !!qualifier.call( elem, i, elem ) !== not;
+ } );
+ }
+
+ // Single element
+ if ( qualifier.nodeType ) {
+ return jQuery.grep( elements, function( elem ) {
+ return ( elem === qualifier ) !== not;
+ } );
+ }
+
+ // Arraylike of elements (jQuery, arguments, Array)
+ if ( typeof qualifier !== "string" ) {
+ return jQuery.grep( elements, function( elem ) {
+ return ( indexOf.call( qualifier, elem ) > -1 ) !== not;
+ } );
+ }
+
+ // Simple selector that can be filtered directly, removing non-Elements
+ if ( risSimple.test( qualifier ) ) {
+ return jQuery.filter( qualifier, elements, not );
+ }
+
+ // Complex selector, compare the two sets, removing non-Elements
+ qualifier = jQuery.filter( qualifier, elements );
+ return jQuery.grep( elements, function( elem ) {
+ return ( indexOf.call( qualifier, elem ) > -1 ) !== not && elem.nodeType === 1;
+ } );
+}
+
+jQuery.filter = function( expr, elems, not ) {
+ var elem = elems[ 0 ];
+
+ if ( not ) {
+ expr = ":not(" + expr + ")";
+ }
+
+ if ( elems.length === 1 && elem.nodeType === 1 ) {
+ return jQuery.find.matchesSelector( elem, expr ) ? [ elem ] : [];
+ }
+
+ return jQuery.find.matches( expr, jQuery.grep( elems, function( elem ) {
+ return elem.nodeType === 1;
+ } ) );
+};
+
+jQuery.fn.extend( {
+ find: function( selector ) {
+ var i, ret,
+ len = this.length,
+ self = this;
+
+ if ( typeof selector !== "string" ) {
+ return this.pushStack( jQuery( selector ).filter( function() {
+ for ( i = 0; i < len; i++ ) {
+ if ( jQuery.contains( self[ i ], this ) ) {
+ return true;
+ }
+ }
+ } ) );
+ }
+
+ ret = this.pushStack( [] );
+
+ for ( i = 0; i < len; i++ ) {
+ jQuery.find( selector, self[ i ], ret );
+ }
+
+ return len > 1 ? jQuery.uniqueSort( ret ) : ret;
+ },
+ filter: function( selector ) {
+ return this.pushStack( winnow( this, selector || [], false ) );
+ },
+ not: function( selector ) {
+ return this.pushStack( winnow( this, selector || [], true ) );
+ },
+ is: function( selector ) {
+ return !!winnow(
+ this,
+
+ // If this is a positional/relative selector, check membership in the returned set
+ // so $("p:first").is("p:last") won't return true for a doc with two "p".
+ typeof selector === "string" && rneedsContext.test( selector ) ?
+ jQuery( selector ) :
+ selector || [],
+ false
+ ).length;
+ }
+} );
+
+
+// Initialize a jQuery object
+
+
+// A central reference to the root jQuery(document)
+var rootjQuery,
+
+ // A simple way to check for HTML strings
+ // Prioritize #id over to avoid XSS via location.hash (#9521)
+ // Strict HTML recognition (#11290: must start with <)
+ // Shortcut simple #id case for speed
+ rquickExpr = /^(?:\s*(<[\w\W]+>)[^>]*|#([\w-]+))$/,
+
+ init = jQuery.fn.init = function( selector, context, root ) {
+ var match, elem;
+
+ // HANDLE: $(""), $(null), $(undefined), $(false)
+ if ( !selector ) {
+ return this;
+ }
+
+ // Method init() accepts an alternate rootjQuery
+ // so migrate can support jQuery.sub (gh-2101)
+ root = root || rootjQuery;
+
+ // Handle HTML strings
+ if ( typeof selector === "string" ) {
+ if ( selector[ 0 ] === "<" &&
+ selector[ selector.length - 1 ] === ">" &&
+ selector.length >= 3 ) {
+
+ // Assume that strings that start and end with <> are HTML and skip the regex check
+ match = [ null, selector, null ];
+
+ } else {
+ match = rquickExpr.exec( selector );
+ }
+
+ // Match html or make sure no context is specified for #id
+ if ( match && ( match[ 1 ] || !context ) ) {
+
+ // HANDLE: $(html) -> $(array)
+ if ( match[ 1 ] ) {
+ context = context instanceof jQuery ? context[ 0 ] : context;
+
+ // Option to run scripts is true for back-compat
+ // Intentionally let the error be thrown if parseHTML is not present
+ jQuery.merge( this, jQuery.parseHTML(
+ match[ 1 ],
+ context && context.nodeType ? context.ownerDocument || context : document,
+ true
+ ) );
+
+ // HANDLE: $(html, props)
+ if ( rsingleTag.test( match[ 1 ] ) && jQuery.isPlainObject( context ) ) {
+ for ( match in context ) {
+
+ // Properties of context are called as methods if possible
+ if ( jQuery.isFunction( this[ match ] ) ) {
+ this[ match ]( context[ match ] );
+
+ // ...and otherwise set as attributes
+ } else {
+ this.attr( match, context[ match ] );
+ }
+ }
+ }
+
+ return this;
+
+ // HANDLE: $(#id)
+ } else {
+ elem = document.getElementById( match[ 2 ] );
+
+ if ( elem ) {
+
+ // Inject the element directly into the jQuery object
+ this[ 0 ] = elem;
+ this.length = 1;
+ }
+ return this;
+ }
+
+ // HANDLE: $(expr, $(...))
+ } else if ( !context || context.jquery ) {
+ return ( context || root ).find( selector );
+
+ // HANDLE: $(expr, context)
+ // (which is just equivalent to: $(context).find(expr)
+ } else {
+ return this.constructor( context ).find( selector );
+ }
+
+ // HANDLE: $(DOMElement)
+ } else if ( selector.nodeType ) {
+ this[ 0 ] = selector;
+ this.length = 1;
+ return this;
+
+ // HANDLE: $(function)
+ // Shortcut for document ready
+ } else if ( jQuery.isFunction( selector ) ) {
+ return root.ready !== undefined ?
+ root.ready( selector ) :
+
+ // Execute immediately if ready is not present
+ selector( jQuery );
+ }
+
+ return jQuery.makeArray( selector, this );
+ };
+
+// Give the init function the jQuery prototype for later instantiation
+init.prototype = jQuery.fn;
+
+// Initialize central reference
+rootjQuery = jQuery( document );
+
+
+var rparentsprev = /^(?:parents|prev(?:Until|All))/,
+
+ // Methods guaranteed to produce a unique set when starting from a unique set
+ guaranteedUnique = {
+ children: true,
+ contents: true,
+ next: true,
+ prev: true
+ };
+
+jQuery.fn.extend( {
+ has: function( target ) {
+ var targets = jQuery( target, this ),
+ l = targets.length;
+
+ return this.filter( function() {
+ var i = 0;
+ for ( ; i < l; i++ ) {
+ if ( jQuery.contains( this, targets[ i ] ) ) {
+ return true;
+ }
+ }
+ } );
+ },
+
+ closest: function( selectors, context ) {
+ var cur,
+ i = 0,
+ l = this.length,
+ matched = [],
+ targets = typeof selectors !== "string" && jQuery( selectors );
+
+ // Positional selectors never match, since there's no _selection_ context
+ if ( !rneedsContext.test( selectors ) ) {
+ for ( ; i < l; i++ ) {
+ for ( cur = this[ i ]; cur && cur !== context; cur = cur.parentNode ) {
+
+ // Always skip document fragments
+ if ( cur.nodeType < 11 && ( targets ?
+ targets.index( cur ) > -1 :
+
+ // Don't pass non-elements to Sizzle
+ cur.nodeType === 1 &&
+ jQuery.find.matchesSelector( cur, selectors ) ) ) {
+
+ matched.push( cur );
+ break;
+ }
+ }
+ }
+ }
+
+ return this.pushStack( matched.length > 1 ? jQuery.uniqueSort( matched ) : matched );
+ },
+
+ // Determine the position of an element within the set
+ index: function( elem ) {
+
+ // No argument, return index in parent
+ if ( !elem ) {
+ return ( this[ 0 ] && this[ 0 ].parentNode ) ? this.first().prevAll().length : -1;
+ }
+
+ // Index in selector
+ if ( typeof elem === "string" ) {
+ return indexOf.call( jQuery( elem ), this[ 0 ] );
+ }
+
+ // Locate the position of the desired element
+ return indexOf.call( this,
+
+ // If it receives a jQuery object, the first element is used
+ elem.jquery ? elem[ 0 ] : elem
+ );
+ },
+
+ add: function( selector, context ) {
+ return this.pushStack(
+ jQuery.uniqueSort(
+ jQuery.merge( this.get(), jQuery( selector, context ) )
+ )
+ );
+ },
+
+ addBack: function( selector ) {
+ return this.add( selector == null ?
+ this.prevObject : this.prevObject.filter( selector )
+ );
+ }
+} );
+
+function sibling( cur, dir ) {
+ while ( ( cur = cur[ dir ] ) && cur.nodeType !== 1 ) {}
+ return cur;
+}
+
+jQuery.each( {
+ parent: function( elem ) {
+ var parent = elem.parentNode;
+ return parent && parent.nodeType !== 11 ? parent : null;
+ },
+ parents: function( elem ) {
+ return dir( elem, "parentNode" );
+ },
+ parentsUntil: function( elem, i, until ) {
+ return dir( elem, "parentNode", until );
+ },
+ next: function( elem ) {
+ return sibling( elem, "nextSibling" );
+ },
+ prev: function( elem ) {
+ return sibling( elem, "previousSibling" );
+ },
+ nextAll: function( elem ) {
+ return dir( elem, "nextSibling" );
+ },
+ prevAll: function( elem ) {
+ return dir( elem, "previousSibling" );
+ },
+ nextUntil: function( elem, i, until ) {
+ return dir( elem, "nextSibling", until );
+ },
+ prevUntil: function( elem, i, until ) {
+ return dir( elem, "previousSibling", until );
+ },
+ siblings: function( elem ) {
+ return siblings( ( elem.parentNode || {} ).firstChild, elem );
+ },
+ children: function( elem ) {
+ return siblings( elem.firstChild );
+ },
+ contents: function( elem ) {
+ if ( nodeName( elem, "iframe" ) ) {
+ return elem.contentDocument;
+ }
+
+ // Support: IE 9 - 11 only, iOS 7 only, Android Browser <=4.3 only
+ // Treat the template element as a regular one in browsers that
+ // don't support it.
+ if ( nodeName( elem, "template" ) ) {
+ elem = elem.content || elem;
+ }
+
+ return jQuery.merge( [], elem.childNodes );
+ }
+}, function( name, fn ) {
+ jQuery.fn[ name ] = function( until, selector ) {
+ var matched = jQuery.map( this, fn, until );
+
+ if ( name.slice( -5 ) !== "Until" ) {
+ selector = until;
+ }
+
+ if ( selector && typeof selector === "string" ) {
+ matched = jQuery.filter( selector, matched );
+ }
+
+ if ( this.length > 1 ) {
+
+ // Remove duplicates
+ if ( !guaranteedUnique[ name ] ) {
+ jQuery.uniqueSort( matched );
+ }
+
+ // Reverse order for parents* and prev-derivatives
+ if ( rparentsprev.test( name ) ) {
+ matched.reverse();
+ }
+ }
+
+ return this.pushStack( matched );
+ };
+} );
+var rnothtmlwhite = ( /[^\x20\t\r\n\f]+/g );
+
+
+
+// Convert String-formatted options into Object-formatted ones
+function createOptions( options ) {
+ var object = {};
+ jQuery.each( options.match( rnothtmlwhite ) || [], function( _, flag ) {
+ object[ flag ] = true;
+ } );
+ return object;
+}
+
+/*
+ * Create a callback list using the following parameters:
+ *
+ * options: an optional list of space-separated options that will change how
+ * the callback list behaves or a more traditional option object
+ *
+ * By default a callback list will act like an event callback list and can be
+ * "fired" multiple times.
+ *
+ * Possible options:
+ *
+ * once: will ensure the callback list can only be fired once (like a Deferred)
+ *
+ * memory: will keep track of previous values and will call any callback added
+ * after the list has been fired right away with the latest "memorized"
+ * values (like a Deferred)
+ *
+ * unique: will ensure a callback can only be added once (no duplicate in the list)
+ *
+ * stopOnFalse: interrupt callings when a callback returns false
+ *
+ */
+jQuery.Callbacks = function( options ) {
+
+ // Convert options from String-formatted to Object-formatted if needed
+ // (we check in cache first)
+ options = typeof options === "string" ?
+ createOptions( options ) :
+ jQuery.extend( {}, options );
+
+ var // Flag to know if list is currently firing
+ firing,
+
+ // Last fire value for non-forgettable lists
+ memory,
+
+ // Flag to know if list was already fired
+ fired,
+
+ // Flag to prevent firing
+ locked,
+
+ // Actual callback list
+ list = [],
+
+ // Queue of execution data for repeatable lists
+ queue = [],
+
+ // Index of currently firing callback (modified by add/remove as needed)
+ firingIndex = -1,
+
+ // Fire callbacks
+ fire = function() {
+
+ // Enforce single-firing
+ locked = locked || options.once;
+
+ // Execute callbacks for all pending executions,
+ // respecting firingIndex overrides and runtime changes
+ fired = firing = true;
+ for ( ; queue.length; firingIndex = -1 ) {
+ memory = queue.shift();
+ while ( ++firingIndex < list.length ) {
+
+ // Run callback and check for early termination
+ if ( list[ firingIndex ].apply( memory[ 0 ], memory[ 1 ] ) === false &&
+ options.stopOnFalse ) {
+
+ // Jump to end and forget the data so .add doesn't re-fire
+ firingIndex = list.length;
+ memory = false;
+ }
+ }
+ }
+
+ // Forget the data if we're done with it
+ if ( !options.memory ) {
+ memory = false;
+ }
+
+ firing = false;
+
+ // Clean up if we're done firing for good
+ if ( locked ) {
+
+ // Keep an empty list if we have data for future add calls
+ if ( memory ) {
+ list = [];
+
+ // Otherwise, this object is spent
+ } else {
+ list = "";
+ }
+ }
+ },
+
+ // Actual Callbacks object
+ self = {
+
+ // Add a callback or a collection of callbacks to the list
+ add: function() {
+ if ( list ) {
+
+ // If we have memory from a past run, we should fire after adding
+ if ( memory && !firing ) {
+ firingIndex = list.length - 1;
+ queue.push( memory );
+ }
+
+ ( function add( args ) {
+ jQuery.each( args, function( _, arg ) {
+ if ( jQuery.isFunction( arg ) ) {
+ if ( !options.unique || !self.has( arg ) ) {
+ list.push( arg );
+ }
+ } else if ( arg && arg.length && jQuery.type( arg ) !== "string" ) {
+
+ // Inspect recursively
+ add( arg );
+ }
+ } );
+ } )( arguments );
+
+ if ( memory && !firing ) {
+ fire();
+ }
+ }
+ return this;
+ },
+
+ // Remove a callback from the list
+ remove: function() {
+ jQuery.each( arguments, function( _, arg ) {
+ var index;
+ while ( ( index = jQuery.inArray( arg, list, index ) ) > -1 ) {
+ list.splice( index, 1 );
+
+ // Handle firing indexes
+ if ( index <= firingIndex ) {
+ firingIndex--;
+ }
+ }
+ } );
+ return this;
+ },
+
+ // Check if a given callback is in the list.
+ // If no argument is given, return whether or not list has callbacks attached.
+ has: function( fn ) {
+ return fn ?
+ jQuery.inArray( fn, list ) > -1 :
+ list.length > 0;
+ },
+
+ // Remove all callbacks from the list
+ empty: function() {
+ if ( list ) {
+ list = [];
+ }
+ return this;
+ },
+
+ // Disable .fire and .add
+ // Abort any current/pending executions
+ // Clear all callbacks and values
+ disable: function() {
+ locked = queue = [];
+ list = memory = "";
+ return this;
+ },
+ disabled: function() {
+ return !list;
+ },
+
+ // Disable .fire
+ // Also disable .add unless we have memory (since it would have no effect)
+ // Abort any pending executions
+ lock: function() {
+ locked = queue = [];
+ if ( !memory && !firing ) {
+ list = memory = "";
+ }
+ return this;
+ },
+ locked: function() {
+ return !!locked;
+ },
+
+ // Call all callbacks with the given context and arguments
+ fireWith: function( context, args ) {
+ if ( !locked ) {
+ args = args || [];
+ args = [ context, args.slice ? args.slice() : args ];
+ queue.push( args );
+ if ( !firing ) {
+ fire();
+ }
+ }
+ return this;
+ },
+
+ // Call all the callbacks with the given arguments
+ fire: function() {
+ self.fireWith( this, arguments );
+ return this;
+ },
+
+ // To know if the callbacks have already been called at least once
+ fired: function() {
+ return !!fired;
+ }
+ };
+
+ return self;
+};
+
+
+function Identity( v ) {
+ return v;
+}
+function Thrower( ex ) {
+ throw ex;
+}
+
+function adoptValue( value, resolve, reject, noValue ) {
+ var method;
+
+ try {
+
+ // Check for promise aspect first to privilege synchronous behavior
+ if ( value && jQuery.isFunction( ( method = value.promise ) ) ) {
+ method.call( value ).done( resolve ).fail( reject );
+
+ // Other thenables
+ } else if ( value && jQuery.isFunction( ( method = value.then ) ) ) {
+ method.call( value, resolve, reject );
+
+ // Other non-thenables
+ } else {
+
+ // Control `resolve` arguments by letting Array#slice cast boolean `noValue` to integer:
+ // * false: [ value ].slice( 0 ) => resolve( value )
+ // * true: [ value ].slice( 1 ) => resolve()
+ resolve.apply( undefined, [ value ].slice( noValue ) );
+ }
+
+ // For Promises/A+, convert exceptions into rejections
+ // Since jQuery.when doesn't unwrap thenables, we can skip the extra checks appearing in
+ // Deferred#then to conditionally suppress rejection.
+ } catch ( value ) {
+
+ // Support: Android 4.0 only
+ // Strict mode functions invoked without .call/.apply get global-object context
+ reject.apply( undefined, [ value ] );
+ }
+}
+
+jQuery.extend( {
+
+ Deferred: function( func ) {
+ var tuples = [
+
+ // action, add listener, callbacks,
+ // ... .then handlers, argument index, [final state]
+ [ "notify", "progress", jQuery.Callbacks( "memory" ),
+ jQuery.Callbacks( "memory" ), 2 ],
+ [ "resolve", "done", jQuery.Callbacks( "once memory" ),
+ jQuery.Callbacks( "once memory" ), 0, "resolved" ],
+ [ "reject", "fail", jQuery.Callbacks( "once memory" ),
+ jQuery.Callbacks( "once memory" ), 1, "rejected" ]
+ ],
+ state = "pending",
+ promise = {
+ state: function() {
+ return state;
+ },
+ always: function() {
+ deferred.done( arguments ).fail( arguments );
+ return this;
+ },
+ "catch": function( fn ) {
+ return promise.then( null, fn );
+ },
+
+ // Keep pipe for back-compat
+ pipe: function( /* fnDone, fnFail, fnProgress */ ) {
+ var fns = arguments;
+
+ return jQuery.Deferred( function( newDefer ) {
+ jQuery.each( tuples, function( i, tuple ) {
+
+ // Map tuples (progress, done, fail) to arguments (done, fail, progress)
+ var fn = jQuery.isFunction( fns[ tuple[ 4 ] ] ) && fns[ tuple[ 4 ] ];
+
+ // deferred.progress(function() { bind to newDefer or newDefer.notify })
+ // deferred.done(function() { bind to newDefer or newDefer.resolve })
+ // deferred.fail(function() { bind to newDefer or newDefer.reject })
+ deferred[ tuple[ 1 ] ]( function() {
+ var returned = fn && fn.apply( this, arguments );
+ if ( returned && jQuery.isFunction( returned.promise ) ) {
+ returned.promise()
+ .progress( newDefer.notify )
+ .done( newDefer.resolve )
+ .fail( newDefer.reject );
+ } else {
+ newDefer[ tuple[ 0 ] + "With" ](
+ this,
+ fn ? [ returned ] : arguments
+ );
+ }
+ } );
+ } );
+ fns = null;
+ } ).promise();
+ },
+ then: function( onFulfilled, onRejected, onProgress ) {
+ var maxDepth = 0;
+ function resolve( depth, deferred, handler, special ) {
+ return function() {
+ var that = this,
+ args = arguments,
+ mightThrow = function() {
+ var returned, then;
+
+ // Support: Promises/A+ section 2.3.3.3.3
+ // https://promisesaplus.com/#point-59
+ // Ignore double-resolution attempts
+ if ( depth < maxDepth ) {
+ return;
+ }
+
+ returned = handler.apply( that, args );
+
+ // Support: Promises/A+ section 2.3.1
+ // https://promisesaplus.com/#point-48
+ if ( returned === deferred.promise() ) {
+ throw new TypeError( "Thenable self-resolution" );
+ }
+
+ // Support: Promises/A+ sections 2.3.3.1, 3.5
+ // https://promisesaplus.com/#point-54
+ // https://promisesaplus.com/#point-75
+ // Retrieve `then` only once
+ then = returned &&
+
+ // Support: Promises/A+ section 2.3.4
+ // https://promisesaplus.com/#point-64
+ // Only check objects and functions for thenability
+ ( typeof returned === "object" ||
+ typeof returned === "function" ) &&
+ returned.then;
+
+ // Handle a returned thenable
+ if ( jQuery.isFunction( then ) ) {
+
+ // Special processors (notify) just wait for resolution
+ if ( special ) {
+ then.call(
+ returned,
+ resolve( maxDepth, deferred, Identity, special ),
+ resolve( maxDepth, deferred, Thrower, special )
+ );
+
+ // Normal processors (resolve) also hook into progress
+ } else {
+
+ // ...and disregard older resolution values
+ maxDepth++;
+
+ then.call(
+ returned,
+ resolve( maxDepth, deferred, Identity, special ),
+ resolve( maxDepth, deferred, Thrower, special ),
+ resolve( maxDepth, deferred, Identity,
+ deferred.notifyWith )
+ );
+ }
+
+ // Handle all other returned values
+ } else {
+
+ // Only substitute handlers pass on context
+ // and multiple values (non-spec behavior)
+ if ( handler !== Identity ) {
+ that = undefined;
+ args = [ returned ];
+ }
+
+ // Process the value(s)
+ // Default process is resolve
+ ( special || deferred.resolveWith )( that, args );
+ }
+ },
+
+ // Only normal processors (resolve) catch and reject exceptions
+ process = special ?
+ mightThrow :
+ function() {
+ try {
+ mightThrow();
+ } catch ( e ) {
+
+ if ( jQuery.Deferred.exceptionHook ) {
+ jQuery.Deferred.exceptionHook( e,
+ process.stackTrace );
+ }
+
+ // Support: Promises/A+ section 2.3.3.3.4.1
+ // https://promisesaplus.com/#point-61
+ // Ignore post-resolution exceptions
+ if ( depth + 1 >= maxDepth ) {
+
+ // Only substitute handlers pass on context
+ // and multiple values (non-spec behavior)
+ if ( handler !== Thrower ) {
+ that = undefined;
+ args = [ e ];
+ }
+
+ deferred.rejectWith( that, args );
+ }
+ }
+ };
+
+ // Support: Promises/A+ section 2.3.3.3.1
+ // https://promisesaplus.com/#point-57
+ // Re-resolve promises immediately to dodge false rejection from
+ // subsequent errors
+ if ( depth ) {
+ process();
+ } else {
+
+ // Call an optional hook to record the stack, in case of exception
+ // since it's otherwise lost when execution goes async
+ if ( jQuery.Deferred.getStackHook ) {
+ process.stackTrace = jQuery.Deferred.getStackHook();
+ }
+ window.setTimeout( process );
+ }
+ };
+ }
+
+ return jQuery.Deferred( function( newDefer ) {
+
+ // progress_handlers.add( ... )
+ tuples[ 0 ][ 3 ].add(
+ resolve(
+ 0,
+ newDefer,
+ jQuery.isFunction( onProgress ) ?
+ onProgress :
+ Identity,
+ newDefer.notifyWith
+ )
+ );
+
+ // fulfilled_handlers.add( ... )
+ tuples[ 1 ][ 3 ].add(
+ resolve(
+ 0,
+ newDefer,
+ jQuery.isFunction( onFulfilled ) ?
+ onFulfilled :
+ Identity
+ )
+ );
+
+ // rejected_handlers.add( ... )
+ tuples[ 2 ][ 3 ].add(
+ resolve(
+ 0,
+ newDefer,
+ jQuery.isFunction( onRejected ) ?
+ onRejected :
+ Thrower
+ )
+ );
+ } ).promise();
+ },
+
+ // Get a promise for this deferred
+ // If obj is provided, the promise aspect is added to the object
+ promise: function( obj ) {
+ return obj != null ? jQuery.extend( obj, promise ) : promise;
+ }
+ },
+ deferred = {};
+
+ // Add list-specific methods
+ jQuery.each( tuples, function( i, tuple ) {
+ var list = tuple[ 2 ],
+ stateString = tuple[ 5 ];
+
+ // promise.progress = list.add
+ // promise.done = list.add
+ // promise.fail = list.add
+ promise[ tuple[ 1 ] ] = list.add;
+
+ // Handle state
+ if ( stateString ) {
+ list.add(
+ function() {
+
+ // state = "resolved" (i.e., fulfilled)
+ // state = "rejected"
+ state = stateString;
+ },
+
+ // rejected_callbacks.disable
+ // fulfilled_callbacks.disable
+ tuples[ 3 - i ][ 2 ].disable,
+
+ // progress_callbacks.lock
+ tuples[ 0 ][ 2 ].lock
+ );
+ }
+
+ // progress_handlers.fire
+ // fulfilled_handlers.fire
+ // rejected_handlers.fire
+ list.add( tuple[ 3 ].fire );
+
+ // deferred.notify = function() { deferred.notifyWith(...) }
+ // deferred.resolve = function() { deferred.resolveWith(...) }
+ // deferred.reject = function() { deferred.rejectWith(...) }
+ deferred[ tuple[ 0 ] ] = function() {
+ deferred[ tuple[ 0 ] + "With" ]( this === deferred ? undefined : this, arguments );
+ return this;
+ };
+
+ // deferred.notifyWith = list.fireWith
+ // deferred.resolveWith = list.fireWith
+ // deferred.rejectWith = list.fireWith
+ deferred[ tuple[ 0 ] + "With" ] = list.fireWith;
+ } );
+
+ // Make the deferred a promise
+ promise.promise( deferred );
+
+ // Call given func if any
+ if ( func ) {
+ func.call( deferred, deferred );
+ }
+
+ // All done!
+ return deferred;
+ },
+
+ // Deferred helper
+ when: function( singleValue ) {
+ var
+
+ // count of uncompleted subordinates
+ remaining = arguments.length,
+
+ // count of unprocessed arguments
+ i = remaining,
+
+ // subordinate fulfillment data
+ resolveContexts = Array( i ),
+ resolveValues = slice.call( arguments ),
+
+ // the master Deferred
+ master = jQuery.Deferred(),
+
+ // subordinate callback factory
+ updateFunc = function( i ) {
+ return function( value ) {
+ resolveContexts[ i ] = this;
+ resolveValues[ i ] = arguments.length > 1 ? slice.call( arguments ) : value;
+ if ( !( --remaining ) ) {
+ master.resolveWith( resolveContexts, resolveValues );
+ }
+ };
+ };
+
+ // Single- and empty arguments are adopted like Promise.resolve
+ if ( remaining <= 1 ) {
+ adoptValue( singleValue, master.done( updateFunc( i ) ).resolve, master.reject,
+ !remaining );
+
+ // Use .then() to unwrap secondary thenables (cf. gh-3000)
+ if ( master.state() === "pending" ||
+ jQuery.isFunction( resolveValues[ i ] && resolveValues[ i ].then ) ) {
+
+ return master.then();
+ }
+ }
+
+ // Multiple arguments are aggregated like Promise.all array elements
+ while ( i-- ) {
+ adoptValue( resolveValues[ i ], updateFunc( i ), master.reject );
+ }
+
+ return master.promise();
+ }
+} );
+
+
+// These usually indicate a programmer mistake during development,
+// warn about them ASAP rather than swallowing them by default.
+var rerrorNames = /^(Eval|Internal|Range|Reference|Syntax|Type|URI)Error$/;
+
+jQuery.Deferred.exceptionHook = function( error, stack ) {
+
+ // Support: IE 8 - 9 only
+ // Console exists when dev tools are open, which can happen at any time
+ if ( window.console && window.console.warn && error && rerrorNames.test( error.name ) ) {
+ window.console.warn( "jQuery.Deferred exception: " + error.message, error.stack, stack );
+ }
+};
+
+
+
+
+jQuery.readyException = function( error ) {
+ window.setTimeout( function() {
+ throw error;
+ } );
+};
+
+
+
+
+// The deferred used on DOM ready
+var readyList = jQuery.Deferred();
+
+jQuery.fn.ready = function( fn ) {
+
+ readyList
+ .then( fn )
+
+ // Wrap jQuery.readyException in a function so that the lookup
+ // happens at the time of error handling instead of callback
+ // registration.
+ .catch( function( error ) {
+ jQuery.readyException( error );
+ } );
+
+ return this;
+};
+
+jQuery.extend( {
+
+ // Is the DOM ready to be used? Set to true once it occurs.
+ isReady: false,
+
+ // A counter to track how many items to wait for before
+ // the ready event fires. See #6781
+ readyWait: 1,
+
+ // Handle when the DOM is ready
+ ready: function( wait ) {
+
+ // Abort if there are pending holds or we're already ready
+ if ( wait === true ? --jQuery.readyWait : jQuery.isReady ) {
+ return;
+ }
+
+ // Remember that the DOM is ready
+ jQuery.isReady = true;
+
+ // If a normal DOM Ready event fired, decrement, and wait if need be
+ if ( wait !== true && --jQuery.readyWait > 0 ) {
+ return;
+ }
+
+ // If there are functions bound, to execute
+ readyList.resolveWith( document, [ jQuery ] );
+ }
+} );
+
+jQuery.ready.then = readyList.then;
+
+// The ready event handler and self cleanup method
+function completed() {
+ document.removeEventListener( "DOMContentLoaded", completed );
+ window.removeEventListener( "load", completed );
+ jQuery.ready();
+}
+
+// Catch cases where $(document).ready() is called
+// after the browser event has already occurred.
+// Support: IE <=9 - 10 only
+// Older IE sometimes signals "interactive" too soon
+if ( document.readyState === "complete" ||
+ ( document.readyState !== "loading" && !document.documentElement.doScroll ) ) {
+
+ // Handle it asynchronously to allow scripts the opportunity to delay ready
+ window.setTimeout( jQuery.ready );
+
+} else {
+
+ // Use the handy event callback
+ document.addEventListener( "DOMContentLoaded", completed );
+
+ // A fallback to window.onload, that will always work
+ window.addEventListener( "load", completed );
+}
+
+
+
+
+// Multifunctional method to get and set values of a collection
+// The value/s can optionally be executed if it's a function
+var access = function( elems, fn, key, value, chainable, emptyGet, raw ) {
+ var i = 0,
+ len = elems.length,
+ bulk = key == null;
+
+ // Sets many values
+ if ( jQuery.type( key ) === "object" ) {
+ chainable = true;
+ for ( i in key ) {
+ access( elems, fn, i, key[ i ], true, emptyGet, raw );
+ }
+
+ // Sets one value
+ } else if ( value !== undefined ) {
+ chainable = true;
+
+ if ( !jQuery.isFunction( value ) ) {
+ raw = true;
+ }
+
+ if ( bulk ) {
+
+ // Bulk operations run against the entire set
+ if ( raw ) {
+ fn.call( elems, value );
+ fn = null;
+
+ // ...except when executing function values
+ } else {
+ bulk = fn;
+ fn = function( elem, key, value ) {
+ return bulk.call( jQuery( elem ), value );
+ };
+ }
+ }
+
+ if ( fn ) {
+ for ( ; i < len; i++ ) {
+ fn(
+ elems[ i ], key, raw ?
+ value :
+ value.call( elems[ i ], i, fn( elems[ i ], key ) )
+ );
+ }
+ }
+ }
+
+ if ( chainable ) {
+ return elems;
+ }
+
+ // Gets
+ if ( bulk ) {
+ return fn.call( elems );
+ }
+
+ return len ? fn( elems[ 0 ], key ) : emptyGet;
+};
+var acceptData = function( owner ) {
+
+ // Accepts only:
+ // - Node
+ // - Node.ELEMENT_NODE
+ // - Node.DOCUMENT_NODE
+ // - Object
+ // - Any
+ return owner.nodeType === 1 || owner.nodeType === 9 || !( +owner.nodeType );
+};
+
+
+
+
+function Data() {
+ this.expando = jQuery.expando + Data.uid++;
+}
+
+Data.uid = 1;
+
+Data.prototype = {
+
+ cache: function( owner ) {
+
+ // Check if the owner object already has a cache
+ var value = owner[ this.expando ];
+
+ // If not, create one
+ if ( !value ) {
+ value = {};
+
+ // We can accept data for non-element nodes in modern browsers,
+ // but we should not, see #8335.
+ // Always return an empty object.
+ if ( acceptData( owner ) ) {
+
+ // If it is a node unlikely to be stringify-ed or looped over
+ // use plain assignment
+ if ( owner.nodeType ) {
+ owner[ this.expando ] = value;
+
+ // Otherwise secure it in a non-enumerable property
+ // configurable must be true to allow the property to be
+ // deleted when data is removed
+ } else {
+ Object.defineProperty( owner, this.expando, {
+ value: value,
+ configurable: true
+ } );
+ }
+ }
+ }
+
+ return value;
+ },
+ set: function( owner, data, value ) {
+ var prop,
+ cache = this.cache( owner );
+
+ // Handle: [ owner, key, value ] args
+ // Always use camelCase key (gh-2257)
+ if ( typeof data === "string" ) {
+ cache[ jQuery.camelCase( data ) ] = value;
+
+ // Handle: [ owner, { properties } ] args
+ } else {
+
+ // Copy the properties one-by-one to the cache object
+ for ( prop in data ) {
+ cache[ jQuery.camelCase( prop ) ] = data[ prop ];
+ }
+ }
+ return cache;
+ },
+ get: function( owner, key ) {
+ return key === undefined ?
+ this.cache( owner ) :
+
+ // Always use camelCase key (gh-2257)
+ owner[ this.expando ] && owner[ this.expando ][ jQuery.camelCase( key ) ];
+ },
+ access: function( owner, key, value ) {
+
+ // In cases where either:
+ //
+ // 1. No key was specified
+ // 2. A string key was specified, but no value provided
+ //
+ // Take the "read" path and allow the get method to determine
+ // which value to return, respectively either:
+ //
+ // 1. The entire cache object
+ // 2. The data stored at the key
+ //
+ if ( key === undefined ||
+ ( ( key && typeof key === "string" ) && value === undefined ) ) {
+
+ return this.get( owner, key );
+ }
+
+ // When the key is not a string, or both a key and value
+ // are specified, set or extend (existing objects) with either:
+ //
+ // 1. An object of properties
+ // 2. A key and value
+ //
+ this.set( owner, key, value );
+
+ // Since the "set" path can have two possible entry points
+ // return the expected data based on which path was taken[*]
+ return value !== undefined ? value : key;
+ },
+ remove: function( owner, key ) {
+ var i,
+ cache = owner[ this.expando ];
+
+ if ( cache === undefined ) {
+ return;
+ }
+
+ if ( key !== undefined ) {
+
+ // Support array or space separated string of keys
+ if ( Array.isArray( key ) ) {
+
+ // If key is an array of keys...
+ // We always set camelCase keys, so remove that.
+ key = key.map( jQuery.camelCase );
+ } else {
+ key = jQuery.camelCase( key );
+
+ // If a key with the spaces exists, use it.
+ // Otherwise, create an array by matching non-whitespace
+ key = key in cache ?
+ [ key ] :
+ ( key.match( rnothtmlwhite ) || [] );
+ }
+
+ i = key.length;
+
+ while ( i-- ) {
+ delete cache[ key[ i ] ];
+ }
+ }
+
+ // Remove the expando if there's no more data
+ if ( key === undefined || jQuery.isEmptyObject( cache ) ) {
+
+ // Support: Chrome <=35 - 45
+ // Webkit & Blink performance suffers when deleting properties
+ // from DOM nodes, so set to undefined instead
+ // https://bugs.chromium.org/p/chromium/issues/detail?id=378607 (bug restricted)
+ if ( owner.nodeType ) {
+ owner[ this.expando ] = undefined;
+ } else {
+ delete owner[ this.expando ];
+ }
+ }
+ },
+ hasData: function( owner ) {
+ var cache = owner[ this.expando ];
+ return cache !== undefined && !jQuery.isEmptyObject( cache );
+ }
+};
+var dataPriv = new Data();
+
+var dataUser = new Data();
+
+
+
+// Implementation Summary
+//
+// 1. Enforce API surface and semantic compatibility with 1.9.x branch
+// 2. Improve the module's maintainability by reducing the storage
+// paths to a single mechanism.
+// 3. Use the same single mechanism to support "private" and "user" data.
+// 4. _Never_ expose "private" data to user code (TODO: Drop _data, _removeData)
+// 5. Avoid exposing implementation details on user objects (eg. expando properties)
+// 6. Provide a clear path for implementation upgrade to WeakMap in 2014
+
+var rbrace = /^(?:\{[\w\W]*\}|\[[\w\W]*\])$/,
+ rmultiDash = /[A-Z]/g;
+
+function getData( data ) {
+ if ( data === "true" ) {
+ return true;
+ }
+
+ if ( data === "false" ) {
+ return false;
+ }
+
+ if ( data === "null" ) {
+ return null;
+ }
+
+ // Only convert to a number if it doesn't change the string
+ if ( data === +data + "" ) {
+ return +data;
+ }
+
+ if ( rbrace.test( data ) ) {
+ return JSON.parse( data );
+ }
+
+ return data;
+}
+
+function dataAttr( elem, key, data ) {
+ var name;
+
+ // If nothing was found internally, try to fetch any
+ // data from the HTML5 data-* attribute
+ if ( data === undefined && elem.nodeType === 1 ) {
+ name = "data-" + key.replace( rmultiDash, "-$&" ).toLowerCase();
+ data = elem.getAttribute( name );
+
+ if ( typeof data === "string" ) {
+ try {
+ data = getData( data );
+ } catch ( e ) {}
+
+ // Make sure we set the data so it isn't changed later
+ dataUser.set( elem, key, data );
+ } else {
+ data = undefined;
+ }
+ }
+ return data;
+}
+
+jQuery.extend( {
+ hasData: function( elem ) {
+ return dataUser.hasData( elem ) || dataPriv.hasData( elem );
+ },
+
+ data: function( elem, name, data ) {
+ return dataUser.access( elem, name, data );
+ },
+
+ removeData: function( elem, name ) {
+ dataUser.remove( elem, name );
+ },
+
+ // TODO: Now that all calls to _data and _removeData have been replaced
+ // with direct calls to dataPriv methods, these can be deprecated.
+ _data: function( elem, name, data ) {
+ return dataPriv.access( elem, name, data );
+ },
+
+ _removeData: function( elem, name ) {
+ dataPriv.remove( elem, name );
+ }
+} );
+
+jQuery.fn.extend( {
+ data: function( key, value ) {
+ var i, name, data,
+ elem = this[ 0 ],
+ attrs = elem && elem.attributes;
+
+ // Gets all values
+ if ( key === undefined ) {
+ if ( this.length ) {
+ data = dataUser.get( elem );
+
+ if ( elem.nodeType === 1 && !dataPriv.get( elem, "hasDataAttrs" ) ) {
+ i = attrs.length;
+ while ( i-- ) {
+
+ // Support: IE 11 only
+ // The attrs elements can be null (#14894)
+ if ( attrs[ i ] ) {
+ name = attrs[ i ].name;
+ if ( name.indexOf( "data-" ) === 0 ) {
+ name = jQuery.camelCase( name.slice( 5 ) );
+ dataAttr( elem, name, data[ name ] );
+ }
+ }
+ }
+ dataPriv.set( elem, "hasDataAttrs", true );
+ }
+ }
+
+ return data;
+ }
+
+ // Sets multiple values
+ if ( typeof key === "object" ) {
+ return this.each( function() {
+ dataUser.set( this, key );
+ } );
+ }
+
+ return access( this, function( value ) {
+ var data;
+
+ // The calling jQuery object (element matches) is not empty
+ // (and therefore has an element appears at this[ 0 ]) and the
+ // `value` parameter was not undefined. An empty jQuery object
+ // will result in `undefined` for elem = this[ 0 ] which will
+ // throw an exception if an attempt to read a data cache is made.
+ if ( elem && value === undefined ) {
+
+ // Attempt to get data from the cache
+ // The key will always be camelCased in Data
+ data = dataUser.get( elem, key );
+ if ( data !== undefined ) {
+ return data;
+ }
+
+ // Attempt to "discover" the data in
+ // HTML5 custom data-* attrs
+ data = dataAttr( elem, key );
+ if ( data !== undefined ) {
+ return data;
+ }
+
+ // We tried really hard, but the data doesn't exist.
+ return;
+ }
+
+ // Set the data...
+ this.each( function() {
+
+ // We always store the camelCased key
+ dataUser.set( this, key, value );
+ } );
+ }, null, value, arguments.length > 1, null, true );
+ },
+
+ removeData: function( key ) {
+ return this.each( function() {
+ dataUser.remove( this, key );
+ } );
+ }
+} );
+
+
+jQuery.extend( {
+ queue: function( elem, type, data ) {
+ var queue;
+
+ if ( elem ) {
+ type = ( type || "fx" ) + "queue";
+ queue = dataPriv.get( elem, type );
+
+ // Speed up dequeue by getting out quickly if this is just a lookup
+ if ( data ) {
+ if ( !queue || Array.isArray( data ) ) {
+ queue = dataPriv.access( elem, type, jQuery.makeArray( data ) );
+ } else {
+ queue.push( data );
+ }
+ }
+ return queue || [];
+ }
+ },
+
+ dequeue: function( elem, type ) {
+ type = type || "fx";
+
+ var queue = jQuery.queue( elem, type ),
+ startLength = queue.length,
+ fn = queue.shift(),
+ hooks = jQuery._queueHooks( elem, type ),
+ next = function() {
+ jQuery.dequeue( elem, type );
+ };
+
+ // If the fx queue is dequeued, always remove the progress sentinel
+ if ( fn === "inprogress" ) {
+ fn = queue.shift();
+ startLength--;
+ }
+
+ if ( fn ) {
+
+ // Add a progress sentinel to prevent the fx queue from being
+ // automatically dequeued
+ if ( type === "fx" ) {
+ queue.unshift( "inprogress" );
+ }
+
+ // Clear up the last queue stop function
+ delete hooks.stop;
+ fn.call( elem, next, hooks );
+ }
+
+ if ( !startLength && hooks ) {
+ hooks.empty.fire();
+ }
+ },
+
+ // Not public - generate a queueHooks object, or return the current one
+ _queueHooks: function( elem, type ) {
+ var key = type + "queueHooks";
+ return dataPriv.get( elem, key ) || dataPriv.access( elem, key, {
+ empty: jQuery.Callbacks( "once memory" ).add( function() {
+ dataPriv.remove( elem, [ type + "queue", key ] );
+ } )
+ } );
+ }
+} );
+
+jQuery.fn.extend( {
+ queue: function( type, data ) {
+ var setter = 2;
+
+ if ( typeof type !== "string" ) {
+ data = type;
+ type = "fx";
+ setter--;
+ }
+
+ if ( arguments.length < setter ) {
+ return jQuery.queue( this[ 0 ], type );
+ }
+
+ return data === undefined ?
+ this :
+ this.each( function() {
+ var queue = jQuery.queue( this, type, data );
+
+ // Ensure a hooks for this queue
+ jQuery._queueHooks( this, type );
+
+ if ( type === "fx" && queue[ 0 ] !== "inprogress" ) {
+ jQuery.dequeue( this, type );
+ }
+ } );
+ },
+ dequeue: function( type ) {
+ return this.each( function() {
+ jQuery.dequeue( this, type );
+ } );
+ },
+ clearQueue: function( type ) {
+ return this.queue( type || "fx", [] );
+ },
+
+ // Get a promise resolved when queues of a certain type
+ // are emptied (fx is the type by default)
+ promise: function( type, obj ) {
+ var tmp,
+ count = 1,
+ defer = jQuery.Deferred(),
+ elements = this,
+ i = this.length,
+ resolve = function() {
+ if ( !( --count ) ) {
+ defer.resolveWith( elements, [ elements ] );
+ }
+ };
+
+ if ( typeof type !== "string" ) {
+ obj = type;
+ type = undefined;
+ }
+ type = type || "fx";
+
+ while ( i-- ) {
+ tmp = dataPriv.get( elements[ i ], type + "queueHooks" );
+ if ( tmp && tmp.empty ) {
+ count++;
+ tmp.empty.add( resolve );
+ }
+ }
+ resolve();
+ return defer.promise( obj );
+ }
+} );
+var pnum = ( /[+-]?(?:\d*\.|)\d+(?:[eE][+-]?\d+|)/ ).source;
+
+var rcssNum = new RegExp( "^(?:([+-])=|)(" + pnum + ")([a-z%]*)$", "i" );
+
+
+var cssExpand = [ "Top", "Right", "Bottom", "Left" ];
+
+var isHiddenWithinTree = function( elem, el ) {
+
+ // isHiddenWithinTree might be called from jQuery#filter function;
+ // in that case, element will be second argument
+ elem = el || elem;
+
+ // Inline style trumps all
+ return elem.style.display === "none" ||
+ elem.style.display === "" &&
+
+ // Otherwise, check computed style
+ // Support: Firefox <=43 - 45
+ // Disconnected elements can have computed display: none, so first confirm that elem is
+ // in the document.
+ jQuery.contains( elem.ownerDocument, elem ) &&
+
+ jQuery.css( elem, "display" ) === "none";
+ };
+
+var swap = function( elem, options, callback, args ) {
+ var ret, name,
+ old = {};
+
+ // Remember the old values, and insert the new ones
+ for ( name in options ) {
+ old[ name ] = elem.style[ name ];
+ elem.style[ name ] = options[ name ];
+ }
+
+ ret = callback.apply( elem, args || [] );
+
+ // Revert the old values
+ for ( name in options ) {
+ elem.style[ name ] = old[ name ];
+ }
+
+ return ret;
+};
+
+
+
+
+function adjustCSS( elem, prop, valueParts, tween ) {
+ var adjusted,
+ scale = 1,
+ maxIterations = 20,
+ currentValue = tween ?
+ function() {
+ return tween.cur();
+ } :
+ function() {
+ return jQuery.css( elem, prop, "" );
+ },
+ initial = currentValue(),
+ unit = valueParts && valueParts[ 3 ] || ( jQuery.cssNumber[ prop ] ? "" : "px" ),
+
+ // Starting value computation is required for potential unit mismatches
+ initialInUnit = ( jQuery.cssNumber[ prop ] || unit !== "px" && +initial ) &&
+ rcssNum.exec( jQuery.css( elem, prop ) );
+
+ if ( initialInUnit && initialInUnit[ 3 ] !== unit ) {
+
+ // Trust units reported by jQuery.css
+ unit = unit || initialInUnit[ 3 ];
+
+ // Make sure we update the tween properties later on
+ valueParts = valueParts || [];
+
+ // Iteratively approximate from a nonzero starting point
+ initialInUnit = +initial || 1;
+
+ do {
+
+ // If previous iteration zeroed out, double until we get *something*.
+ // Use string for doubling so we don't accidentally see scale as unchanged below
+ scale = scale || ".5";
+
+ // Adjust and apply
+ initialInUnit = initialInUnit / scale;
+ jQuery.style( elem, prop, initialInUnit + unit );
+
+ // Update scale, tolerating zero or NaN from tween.cur()
+ // Break the loop if scale is unchanged or perfect, or if we've just had enough.
+ } while (
+ scale !== ( scale = currentValue() / initial ) && scale !== 1 && --maxIterations
+ );
+ }
+
+ if ( valueParts ) {
+ initialInUnit = +initialInUnit || +initial || 0;
+
+ // Apply relative offset (+=/-=) if specified
+ adjusted = valueParts[ 1 ] ?
+ initialInUnit + ( valueParts[ 1 ] + 1 ) * valueParts[ 2 ] :
+ +valueParts[ 2 ];
+ if ( tween ) {
+ tween.unit = unit;
+ tween.start = initialInUnit;
+ tween.end = adjusted;
+ }
+ }
+ return adjusted;
+}
+
+
+var defaultDisplayMap = {};
+
+function getDefaultDisplay( elem ) {
+ var temp,
+ doc = elem.ownerDocument,
+ nodeName = elem.nodeName,
+ display = defaultDisplayMap[ nodeName ];
+
+ if ( display ) {
+ return display;
+ }
+
+ temp = doc.body.appendChild( doc.createElement( nodeName ) );
+ display = jQuery.css( temp, "display" );
+
+ temp.parentNode.removeChild( temp );
+
+ if ( display === "none" ) {
+ display = "block";
+ }
+ defaultDisplayMap[ nodeName ] = display;
+
+ return display;
+}
+
+function showHide( elements, show ) {
+ var display, elem,
+ values = [],
+ index = 0,
+ length = elements.length;
+
+ // Determine new display value for elements that need to change
+ for ( ; index < length; index++ ) {
+ elem = elements[ index ];
+ if ( !elem.style ) {
+ continue;
+ }
+
+ display = elem.style.display;
+ if ( show ) {
+
+ // Since we force visibility upon cascade-hidden elements, an immediate (and slow)
+ // check is required in this first loop unless we have a nonempty display value (either
+ // inline or about-to-be-restored)
+ if ( display === "none" ) {
+ values[ index ] = dataPriv.get( elem, "display" ) || null;
+ if ( !values[ index ] ) {
+ elem.style.display = "";
+ }
+ }
+ if ( elem.style.display === "" && isHiddenWithinTree( elem ) ) {
+ values[ index ] = getDefaultDisplay( elem );
+ }
+ } else {
+ if ( display !== "none" ) {
+ values[ index ] = "none";
+
+ // Remember what we're overwriting
+ dataPriv.set( elem, "display", display );
+ }
+ }
+ }
+
+ // Set the display of the elements in a second loop to avoid constant reflow
+ for ( index = 0; index < length; index++ ) {
+ if ( values[ index ] != null ) {
+ elements[ index ].style.display = values[ index ];
+ }
+ }
+
+ return elements;
+}
+
+jQuery.fn.extend( {
+ show: function() {
+ return showHide( this, true );
+ },
+ hide: function() {
+ return showHide( this );
+ },
+ toggle: function( state ) {
+ if ( typeof state === "boolean" ) {
+ return state ? this.show() : this.hide();
+ }
+
+ return this.each( function() {
+ if ( isHiddenWithinTree( this ) ) {
+ jQuery( this ).show();
+ } else {
+ jQuery( this ).hide();
+ }
+ } );
+ }
+} );
+var rcheckableType = ( /^(?:checkbox|radio)$/i );
+
+var rtagName = ( /<([a-z][^\/\0>\x20\t\r\n\f]+)/i );
+
+var rscriptType = ( /^$|\/(?:java|ecma)script/i );
+
+
+
+// We have to close these tags to support XHTML (#13200)
+var wrapMap = {
+
+ // Support: IE <=9 only
+ option: [ 1, "" ],
+
+ // XHTML parsers do not magically insert elements in the
+ // same way that tag soup parsers do. So we cannot shorten
+ // this by omitting or other required elements.
+ thead: [ 1, "" ],
+ col: [ 2, "" ],
+ tr: [ 2, "" ],
+ td: [ 3, "" ],
+
+ _default: [ 0, "", "" ]
+};
+
+// Support: IE <=9 only
+wrapMap.optgroup = wrapMap.option;
+
+wrapMap.tbody = wrapMap.tfoot = wrapMap.colgroup = wrapMap.caption = wrapMap.thead;
+wrapMap.th = wrapMap.td;
+
+
+function getAll( context, tag ) {
+
+ // Support: IE <=9 - 11 only
+ // Use typeof to avoid zero-argument method invocation on host objects (#15151)
+ var ret;
+
+ if ( typeof context.getElementsByTagName !== "undefined" ) {
+ ret = context.getElementsByTagName( tag || "*" );
+
+ } else if ( typeof context.querySelectorAll !== "undefined" ) {
+ ret = context.querySelectorAll( tag || "*" );
+
+ } else {
+ ret = [];
+ }
+
+ if ( tag === undefined || tag && nodeName( context, tag ) ) {
+ return jQuery.merge( [ context ], ret );
+ }
+
+ return ret;
+}
+
+
+// Mark scripts as having already been evaluated
+function setGlobalEval( elems, refElements ) {
+ var i = 0,
+ l = elems.length;
+
+ for ( ; i < l; i++ ) {
+ dataPriv.set(
+ elems[ i ],
+ "globalEval",
+ !refElements || dataPriv.get( refElements[ i ], "globalEval" )
+ );
+ }
+}
+
+
+var rhtml = /<|?\w+;/;
+
+function buildFragment( elems, context, scripts, selection, ignored ) {
+ var elem, tmp, tag, wrap, contains, j,
+ fragment = context.createDocumentFragment(),
+ nodes = [],
+ i = 0,
+ l = elems.length;
+
+ for ( ; i < l; i++ ) {
+ elem = elems[ i ];
+
+ if ( elem || elem === 0 ) {
+
+ // Add nodes directly
+ if ( jQuery.type( elem ) === "object" ) {
+
+ // Support: Android <=4.0 only, PhantomJS 1 only
+ // push.apply(_, arraylike) throws on ancient WebKit
+ jQuery.merge( nodes, elem.nodeType ? [ elem ] : elem );
+
+ // Convert non-html into a text node
+ } else if ( !rhtml.test( elem ) ) {
+ nodes.push( context.createTextNode( elem ) );
+
+ // Convert html into DOM nodes
+ } else {
+ tmp = tmp || fragment.appendChild( context.createElement( "div" ) );
+
+ // Deserialize a standard representation
+ tag = ( rtagName.exec( elem ) || [ "", "" ] )[ 1 ].toLowerCase();
+ wrap = wrapMap[ tag ] || wrapMap._default;
+ tmp.innerHTML = wrap[ 1 ] + jQuery.htmlPrefilter( elem ) + wrap[ 2 ];
+
+ // Descend through wrappers to the right content
+ j = wrap[ 0 ];
+ while ( j-- ) {
+ tmp = tmp.lastChild;
+ }
+
+ // Support: Android <=4.0 only, PhantomJS 1 only
+ // push.apply(_, arraylike) throws on ancient WebKit
+ jQuery.merge( nodes, tmp.childNodes );
+
+ // Remember the top-level container
+ tmp = fragment.firstChild;
+
+ // Ensure the created nodes are orphaned (#12392)
+ tmp.textContent = "";
+ }
+ }
+ }
+
+ // Remove wrapper from fragment
+ fragment.textContent = "";
+
+ i = 0;
+ while ( ( elem = nodes[ i++ ] ) ) {
+
+ // Skip elements already in the context collection (trac-4087)
+ if ( selection && jQuery.inArray( elem, selection ) > -1 ) {
+ if ( ignored ) {
+ ignored.push( elem );
+ }
+ continue;
+ }
+
+ contains = jQuery.contains( elem.ownerDocument, elem );
+
+ // Append to fragment
+ tmp = getAll( fragment.appendChild( elem ), "script" );
+
+ // Preserve script evaluation history
+ if ( contains ) {
+ setGlobalEval( tmp );
+ }
+
+ // Capture executables
+ if ( scripts ) {
+ j = 0;
+ while ( ( elem = tmp[ j++ ] ) ) {
+ if ( rscriptType.test( elem.type || "" ) ) {
+ scripts.push( elem );
+ }
+ }
+ }
+ }
+
+ return fragment;
+}
+
+
+( function() {
+ var fragment = document.createDocumentFragment(),
+ div = fragment.appendChild( document.createElement( "div" ) ),
+ input = document.createElement( "input" );
+
+ // Support: Android 4.0 - 4.3 only
+ // Check state lost if the name is set (#11217)
+ // Support: Windows Web Apps (WWA)
+ // `name` and `type` must use .setAttribute for WWA (#14901)
+ input.setAttribute( "type", "radio" );
+ input.setAttribute( "checked", "checked" );
+ input.setAttribute( "name", "t" );
+
+ div.appendChild( input );
+
+ // Support: Android <=4.1 only
+ // Older WebKit doesn't clone checked state correctly in fragments
+ support.checkClone = div.cloneNode( true ).cloneNode( true ).lastChild.checked;
+
+ // Support: IE <=11 only
+ // Make sure textarea (and checkbox) defaultValue is properly cloned
+ div.innerHTML = "";
+ support.noCloneChecked = !!div.cloneNode( true ).lastChild.defaultValue;
+} )();
+var documentElement = document.documentElement;
+
+
+
+var
+ rkeyEvent = /^key/,
+ rmouseEvent = /^(?:mouse|pointer|contextmenu|drag|drop)|click/,
+ rtypenamespace = /^([^.]*)(?:\.(.+)|)/;
+
+function returnTrue() {
+ return true;
+}
+
+function returnFalse() {
+ return false;
+}
+
+// Support: IE <=9 only
+// See #13393 for more info
+function safeActiveElement() {
+ try {
+ return document.activeElement;
+ } catch ( err ) { }
+}
+
+function on( elem, types, selector, data, fn, one ) {
+ var origFn, type;
+
+ // Types can be a map of types/handlers
+ if ( typeof types === "object" ) {
+
+ // ( types-Object, selector, data )
+ if ( typeof selector !== "string" ) {
+
+ // ( types-Object, data )
+ data = data || selector;
+ selector = undefined;
+ }
+ for ( type in types ) {
+ on( elem, type, selector, data, types[ type ], one );
+ }
+ return elem;
+ }
+
+ if ( data == null && fn == null ) {
+
+ // ( types, fn )
+ fn = selector;
+ data = selector = undefined;
+ } else if ( fn == null ) {
+ if ( typeof selector === "string" ) {
+
+ // ( types, selector, fn )
+ fn = data;
+ data = undefined;
+ } else {
+
+ // ( types, data, fn )
+ fn = data;
+ data = selector;
+ selector = undefined;
+ }
+ }
+ if ( fn === false ) {
+ fn = returnFalse;
+ } else if ( !fn ) {
+ return elem;
+ }
+
+ if ( one === 1 ) {
+ origFn = fn;
+ fn = function( event ) {
+
+ // Can use an empty set, since event contains the info
+ jQuery().off( event );
+ return origFn.apply( this, arguments );
+ };
+
+ // Use same guid so caller can remove using origFn
+ fn.guid = origFn.guid || ( origFn.guid = jQuery.guid++ );
+ }
+ return elem.each( function() {
+ jQuery.event.add( this, types, fn, data, selector );
+ } );
+}
+
+/*
+ * Helper functions for managing events -- not part of the public interface.
+ * Props to Dean Edwards' addEvent library for many of the ideas.
+ */
+jQuery.event = {
+
+ global: {},
+
+ add: function( elem, types, handler, data, selector ) {
+
+ var handleObjIn, eventHandle, tmp,
+ events, t, handleObj,
+ special, handlers, type, namespaces, origType,
+ elemData = dataPriv.get( elem );
+
+ // Don't attach events to noData or text/comment nodes (but allow plain objects)
+ if ( !elemData ) {
+ return;
+ }
+
+ // Caller can pass in an object of custom data in lieu of the handler
+ if ( handler.handler ) {
+ handleObjIn = handler;
+ handler = handleObjIn.handler;
+ selector = handleObjIn.selector;
+ }
+
+ // Ensure that invalid selectors throw exceptions at attach time
+ // Evaluate against documentElement in case elem is a non-element node (e.g., document)
+ if ( selector ) {
+ jQuery.find.matchesSelector( documentElement, selector );
+ }
+
+ // Make sure that the handler has a unique ID, used to find/remove it later
+ if ( !handler.guid ) {
+ handler.guid = jQuery.guid++;
+ }
+
+ // Init the element's event structure and main handler, if this is the first
+ if ( !( events = elemData.events ) ) {
+ events = elemData.events = {};
+ }
+ if ( !( eventHandle = elemData.handle ) ) {
+ eventHandle = elemData.handle = function( e ) {
+
+ // Discard the second event of a jQuery.event.trigger() and
+ // when an event is called after a page has unloaded
+ return typeof jQuery !== "undefined" && jQuery.event.triggered !== e.type ?
+ jQuery.event.dispatch.apply( elem, arguments ) : undefined;
+ };
+ }
+
+ // Handle multiple events separated by a space
+ types = ( types || "" ).match( rnothtmlwhite ) || [ "" ];
+ t = types.length;
+ while ( t-- ) {
+ tmp = rtypenamespace.exec( types[ t ] ) || [];
+ type = origType = tmp[ 1 ];
+ namespaces = ( tmp[ 2 ] || "" ).split( "." ).sort();
+
+ // There *must* be a type, no attaching namespace-only handlers
+ if ( !type ) {
+ continue;
+ }
+
+ // If event changes its type, use the special event handlers for the changed type
+ special = jQuery.event.special[ type ] || {};
+
+ // If selector defined, determine special event api type, otherwise given type
+ type = ( selector ? special.delegateType : special.bindType ) || type;
+
+ // Update special based on newly reset type
+ special = jQuery.event.special[ type ] || {};
+
+ // handleObj is passed to all event handlers
+ handleObj = jQuery.extend( {
+ type: type,
+ origType: origType,
+ data: data,
+ handler: handler,
+ guid: handler.guid,
+ selector: selector,
+ needsContext: selector && jQuery.expr.match.needsContext.test( selector ),
+ namespace: namespaces.join( "." )
+ }, handleObjIn );
+
+ // Init the event handler queue if we're the first
+ if ( !( handlers = events[ type ] ) ) {
+ handlers = events[ type ] = [];
+ handlers.delegateCount = 0;
+
+ // Only use addEventListener if the special events handler returns false
+ if ( !special.setup ||
+ special.setup.call( elem, data, namespaces, eventHandle ) === false ) {
+
+ if ( elem.addEventListener ) {
+ elem.addEventListener( type, eventHandle );
+ }
+ }
+ }
+
+ if ( special.add ) {
+ special.add.call( elem, handleObj );
+
+ if ( !handleObj.handler.guid ) {
+ handleObj.handler.guid = handler.guid;
+ }
+ }
+
+ // Add to the element's handler list, delegates in front
+ if ( selector ) {
+ handlers.splice( handlers.delegateCount++, 0, handleObj );
+ } else {
+ handlers.push( handleObj );
+ }
+
+ // Keep track of which events have ever been used, for event optimization
+ jQuery.event.global[ type ] = true;
+ }
+
+ },
+
+ // Detach an event or set of events from an element
+ remove: function( elem, types, handler, selector, mappedTypes ) {
+
+ var j, origCount, tmp,
+ events, t, handleObj,
+ special, handlers, type, namespaces, origType,
+ elemData = dataPriv.hasData( elem ) && dataPriv.get( elem );
+
+ if ( !elemData || !( events = elemData.events ) ) {
+ return;
+ }
+
+ // Once for each type.namespace in types; type may be omitted
+ types = ( types || "" ).match( rnothtmlwhite ) || [ "" ];
+ t = types.length;
+ while ( t-- ) {
+ tmp = rtypenamespace.exec( types[ t ] ) || [];
+ type = origType = tmp[ 1 ];
+ namespaces = ( tmp[ 2 ] || "" ).split( "." ).sort();
+
+ // Unbind all events (on this namespace, if provided) for the element
+ if ( !type ) {
+ for ( type in events ) {
+ jQuery.event.remove( elem, type + types[ t ], handler, selector, true );
+ }
+ continue;
+ }
+
+ special = jQuery.event.special[ type ] || {};
+ type = ( selector ? special.delegateType : special.bindType ) || type;
+ handlers = events[ type ] || [];
+ tmp = tmp[ 2 ] &&
+ new RegExp( "(^|\\.)" + namespaces.join( "\\.(?:.*\\.|)" ) + "(\\.|$)" );
+
+ // Remove matching events
+ origCount = j = handlers.length;
+ while ( j-- ) {
+ handleObj = handlers[ j ];
+
+ if ( ( mappedTypes || origType === handleObj.origType ) &&
+ ( !handler || handler.guid === handleObj.guid ) &&
+ ( !tmp || tmp.test( handleObj.namespace ) ) &&
+ ( !selector || selector === handleObj.selector ||
+ selector === "**" && handleObj.selector ) ) {
+ handlers.splice( j, 1 );
+
+ if ( handleObj.selector ) {
+ handlers.delegateCount--;
+ }
+ if ( special.remove ) {
+ special.remove.call( elem, handleObj );
+ }
+ }
+ }
+
+ // Remove generic event handler if we removed something and no more handlers exist
+ // (avoids potential for endless recursion during removal of special event handlers)
+ if ( origCount && !handlers.length ) {
+ if ( !special.teardown ||
+ special.teardown.call( elem, namespaces, elemData.handle ) === false ) {
+
+ jQuery.removeEvent( elem, type, elemData.handle );
+ }
+
+ delete events[ type ];
+ }
+ }
+
+ // Remove data and the expando if it's no longer used
+ if ( jQuery.isEmptyObject( events ) ) {
+ dataPriv.remove( elem, "handle events" );
+ }
+ },
+
+ dispatch: function( nativeEvent ) {
+
+ // Make a writable jQuery.Event from the native event object
+ var event = jQuery.event.fix( nativeEvent );
+
+ var i, j, ret, matched, handleObj, handlerQueue,
+ args = new Array( arguments.length ),
+ handlers = ( dataPriv.get( this, "events" ) || {} )[ event.type ] || [],
+ special = jQuery.event.special[ event.type ] || {};
+
+ // Use the fix-ed jQuery.Event rather than the (read-only) native event
+ args[ 0 ] = event;
+
+ for ( i = 1; i < arguments.length; i++ ) {
+ args[ i ] = arguments[ i ];
+ }
+
+ event.delegateTarget = this;
+
+ // Call the preDispatch hook for the mapped type, and let it bail if desired
+ if ( special.preDispatch && special.preDispatch.call( this, event ) === false ) {
+ return;
+ }
+
+ // Determine handlers
+ handlerQueue = jQuery.event.handlers.call( this, event, handlers );
+
+ // Run delegates first; they may want to stop propagation beneath us
+ i = 0;
+ while ( ( matched = handlerQueue[ i++ ] ) && !event.isPropagationStopped() ) {
+ event.currentTarget = matched.elem;
+
+ j = 0;
+ while ( ( handleObj = matched.handlers[ j++ ] ) &&
+ !event.isImmediatePropagationStopped() ) {
+
+ // Triggered event must either 1) have no namespace, or 2) have namespace(s)
+ // a subset or equal to those in the bound event (both can have no namespace).
+ if ( !event.rnamespace || event.rnamespace.test( handleObj.namespace ) ) {
+
+ event.handleObj = handleObj;
+ event.data = handleObj.data;
+
+ ret = ( ( jQuery.event.special[ handleObj.origType ] || {} ).handle ||
+ handleObj.handler ).apply( matched.elem, args );
+
+ if ( ret !== undefined ) {
+ if ( ( event.result = ret ) === false ) {
+ event.preventDefault();
+ event.stopPropagation();
+ }
+ }
+ }
+ }
+ }
+
+ // Call the postDispatch hook for the mapped type
+ if ( special.postDispatch ) {
+ special.postDispatch.call( this, event );
+ }
+
+ return event.result;
+ },
+
+ handlers: function( event, handlers ) {
+ var i, handleObj, sel, matchedHandlers, matchedSelectors,
+ handlerQueue = [],
+ delegateCount = handlers.delegateCount,
+ cur = event.target;
+
+ // Find delegate handlers
+ if ( delegateCount &&
+
+ // Support: IE <=9
+ // Black-hole SVG