You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
The text was updated successfully, but these errors were encountered:
lichangyaya
changed the title
Why do I run an empty output file according to the readme rules?
Why do I get an empty output file when I run it according to the rules of the readme file?
Jan 5, 2024
lichangyaya
changed the title
Why do I get an empty output file when I run it according to the rules of the readme file?
Why do I get an empty output file?
Jan 5, 2024
Are all the output files in the out/GRCh37_test15/ints empty? If isling ran without any errors (snakemake will report failed jobs), then the most likely explanation is that your data doesn't contain integration sites.
Hello,
My input file is GRCh37 human gene and virus gene, why can't I get the output file.
The configuration file is as follows:
snakedir: "/home/lc/isling"
global:
out_dir: "out/GRCh37_test15"
read information
read_folder: "test/reads/"
R1_suffix: "_001.fastq"
R2_suffix: "_002.fastq"
read1-adapt: "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
read2-adapt: "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
split: 3
mean-frag-len: "estimate"
read preprocessing options
dedup: True
merge: True
trim: True
dedup-subs: 2
alignment options
host_name: "GRCh37"
host_fasta: "test/references/GRCh37.fa"
virus_name: "10791"
virus_fasta: "test/references/10791.fa"
bwa-mem: "-a -t 4 -k 15 -W 25 -r 1.0 -A 1 -B 3 -O 5,5 -E 1,1 -L 0 -U 15 -T 0"
align-cpus: 4
integration detection options
clip-cutoff: 20
cigar-tol: 3
alt-edit-dist-thresh: 2
alt-edit-dist-thresh-pc: 0.6
filter:
bed-exclude:
merge-method: 'common'
merge-n-min: 1
mapq-threshold: 20
test-merge:
merge: True
The text was updated successfully, but these errors were encountered: