activity2.ipynb

{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Day One: Activity Two"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Printing Code"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "##To print code\n",
    "print(\"Hello World\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#Print a message of your choice\n",
    "print(\"\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Variables"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#assign a variable name to a DNA sequence\n",
    "mydna=\"ATAC\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#print mydna\n",
    "print(mydna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#Print the statement \"My sequence is: ATAC\" by combining the mydna variable and \"My sequence is:\" in the print statement \n",
    "print()"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Data Types"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#assign the following variable names and check the type\n",
    "#1,\"twenty\", 16.8, \"dna\",1/2\n",
    "#example\n",
    "x=1\n",
    "type(x)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#\"twenty\"\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#16.8\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#\"dna\"\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#1/2\n"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Analysing Data"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#data \n",
    "myseq=\"ATACTATATATATCATAGATACATGACATACAGATACAGATCATAATCATGATACTA\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#get the length \n",
    "len()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#how many A's\n",
    "#use count()\n",
    "myseq.count(\"A\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#how many G's\n",
    "#use count()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#how many T's\n",
    "#use count()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#how many C's\n",
    "#use count()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#Add the following to myseq \"ATATATAT\"\n",
    "mynewseq="
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#replace C with G\n"
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.7.3"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 2
}