I obtained different 'insert size peaks' when I used different options for the same paired-end sequencing sample.

[Eunyoung-Oh114]

I obtained different 'insert size peaks' when I used different options for the same paired-end sequencing sample.
I used the fastp v0.23.4
Different options are "--length_required 36 --cut_front --cut_front_window_size=1 --cut_front_mean_quality=3 --cut_tail --cut_tail_window_size=1 --cut_tail_mean_quality=3 --cut_right --cut_right_window_size=4 --cut_right_mean_quality=20"
For case 1, I got "insert size peaks : 271"
For case 2, I got "insert size peaks : 151"
I used same sample both case 1 and case 2.

Does anyone know why the results turned out differently?

Case 1

• Command : fastp --in1 sample_R1.fastq.gz --out1 sample_R1_trimmed.fastq.gz --in2 sample_R2.fastq.gz --out2 sample_R2_trimmed.fastq.gz --unpaired1 sample_R1_unpaired.fastq.gz --unpaired2 sample_R2_unpaired.fastq.gz --failed_out sample_failed.fastq.gz --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --trim_poly_g --dedup --qualified_quality_phred 30 --correction --overrepresentation_analysis --html sample_QC.html
• Insert size peak (evaluated by paired-end reads): 271
• Additional Information for the Case 1

Read1 before filtering:
total reads: 326969673
total bases: 49372420623
Q20 bases: 48274898763(97.7771%)
Q30 bases: 46395487732(93.9705%)

Read2 before filtering:
total reads: 326969673
total bases: 49372420623
Q20 bases: 47784347724(96.7835%)
Q30 bases: 45348520572(91.8499%)

Read1 after filtering:
total reads: 292663122
total bases: 43989331588
Q20 bases: 43278761283(98.3847%)
Q30 bases: 41716188664(94.8325%)

Read2 after filtering:
total reads: 292663122
total bases: 43987040549
Q20 bases: 42997269531(97.7499%)
Q30 bases: 40958413815(93.1147%)

Filtering result:
reads passed filter: 630257560
reads failed due to low quality: 23272690
reads failed due to too many N: 101974
reads failed due to too short: 307122
reads with adapter trimmed: 6932900
bases trimmed due to adapters: 415722706
reads corrected by overlap analysis: 4577467
bases corrected by overlap analysis: 12747084

Duplication rate: 6.9374%

Insert size peak (evaluated by paired-end reads): 271

Case2

• Command : fastp --in1 sample_R1.fastq.gz --out1 sample_R1_trimmed.fastq.gz --in2 sample_R2.fastq.gz --out2 sample_R2_trimmed.fastq.gz --unpaired1 sample_R1_unpaired.fastq.gz --unpaired2 sample_R2_unpaired.fastq.gz --failed_out sample_failed.fastq.gz --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --trim_poly_g --dedup --qualified_quality_phred 30 --correction --overrepresentation_analysis --html sample_QC.html --json sample_QC.json --length_required 36 --cut_front --cut_front_window_size=1 --cut_front_mean_quality=3 --cut_tail --cut_tail_window_size=1 --cut_tail_mean_quality=3 --cut_right --cut_right_window_size=4 --cut_right_mean_quality=20
• Insert size peak (evaluated by paired-end reads): 151
• Additional Information for the Case 2

Read1 before filtering:
total reads: 326969673
total bases: 49372420623
Q20 bases: 48274898763(97.7771%)
Q30 bases: 46395487732(93.9705%)

Read2 before filtering:
total reads: 326969673
total bases: 49372420623
Q20 bases: 47784347724(96.7835%)
Q30 bases: 45348520572(91.8499%)

Read1 after filtering:
total reads: 293114436
total bases: 43166016157
Q20 bases: 42676330864(98.8656%)
Q30 bases: 41264878670(95.5958%)

Read2 after filtering:
total reads: 293114436
total bases: 42964229053
Q20 bases: 42244269978(98.3243%)
Q30 bases: 40377376806(93.9791%)

Filtering result:
reads passed filter: 631089144
reads failed due to low quality: 4393848
reads failed due to too many N: 1796
reads failed due to too short: 18454558
reads with adapter trimmed: 6634714
bases trimmed due to adapters: 325223066
reads corrected by overlap analysis: 4273309
bases corrected by overlap analysis: 7820628

Duplication rate: 6.9374%

Insert size peak (evaluated by paired-end reads): 151